ID: 1062353223

View in Genome Browser
Species Human (GRCh38)
Location 9:136149174-136149196
Sequence TGGGAAGTGCACAGGCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353223_1062353231 -2 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353223_1062353232 -1 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353232 9:136149196-136149218 AGGCTGCAGGACACAACCTCGGG 0: 1
1: 0
2: 1
3: 13
4: 199
1062353223_1062353237 29 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353223_1062353234 19 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353223 Original CRISPR TGGGAAGTGCACAGGCCTCG GGG (reversed) Intergenic