ID: 1062353224

View in Genome Browser
Species Human (GRCh38)
Location 9:136149175-136149197
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353224_1062353231 -3 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353224_1062353237 28 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353224_1062353232 -2 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353232 9:136149196-136149218 AGGCTGCAGGACACAACCTCGGG No data
1062353224_1062353234 18 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353224 Original CRISPR CTGGGAAGTGCACAGGCCTC GGG (reversed) Intergenic