ID: 1062353227

View in Genome Browser
Species Human (GRCh38)
Location 9:136149182-136149204
Sequence CTGCAGCCTGGGAAGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353227_1062353231 -10 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353227_1062353237 21 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353227_1062353234 11 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353227_1062353241 30 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353227_1062353232 -9 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353232 9:136149196-136149218 AGGCTGCAGGACACAACCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353227 Original CRISPR CTGCAGCCTGGGAAGTGCAC AGG (reversed) Intergenic