ID: 1062353229

View in Genome Browser
Species Human (GRCh38)
Location 9:136149193-136149215
Sequence GAGGTTGTGTCCTGCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353229_1062353237 10 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353229_1062353234 0 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353229_1062353241 19 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353229 Original CRISPR GAGGTTGTGTCCTGCAGCCT GGG (reversed) Intergenic