ID: 1062353230

View in Genome Browser
Species Human (GRCh38)
Location 9:136149194-136149216
Sequence CGAGGTTGTGTCCTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353230_1062353237 9 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353230_1062353241 18 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353230_1062353234 -1 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353230 Original CRISPR CGAGGTTGTGTCCTGCAGCC TGG (reversed) Intergenic