ID: 1062353231

View in Genome Browser
Species Human (GRCh38)
Location 9:136149195-136149217
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353227_1062353231 -10 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353224_1062353231 -3 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353223_1062353231 -2 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353225_1062353231 -4 Left 1062353225 9:136149176-136149198 CCGAGGCCTGTGCACTTCCCAGG No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data
1062353221_1062353231 20 Left 1062353221 9:136149152-136149174 CCTCACTCTGTGAAAATGGCAGC No data
Right 1062353231 9:136149195-136149217 CAGGCTGCAGGACACAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353231 Original CRISPR CAGGCTGCAGGACACAACCT CGG Intergenic