ID: 1062353233

View in Genome Browser
Species Human (GRCh38)
Location 9:136149212-136149234
Sequence TGGGGACGGCTCAAGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353233_1062353241 0 Left 1062353233 9:136149212-136149234 CCTCGGGCCTTGAGCCGTCCCCA No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG 0: 1
1: 0
2: 5
3: 76
4: 578
1062353233_1062353237 -9 Left 1062353233 9:136149212-136149234 CCTCGGGCCTTGAGCCGTCCCCA No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353233_1062353245 24 Left 1062353233 9:136149212-136149234 CCTCGGGCCTTGAGCCGTCCCCA No data
Right 1062353245 9:136149259-136149281 TCCACCCCTCAGCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353233 Original CRISPR TGGGGACGGCTCAAGGCCCG AGG (reversed) Intergenic