ID: 1062353234

View in Genome Browser
Species Human (GRCh38)
Location 9:136149216-136149238
Sequence GGGCCTTGAGCCGTCCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353229_1062353234 0 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353223_1062353234 19 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353224_1062353234 18 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353227_1062353234 11 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353225_1062353234 17 Left 1062353225 9:136149176-136149198 CCGAGGCCTGTGCACTTCCCAGG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data
1062353230_1062353234 -1 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353234 9:136149216-136149238 GGGCCTTGAGCCGTCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353234 Original CRISPR GGGCCTTGAGCCGTCCCCAC AGG Intergenic