ID: 1062353237

View in Genome Browser
Species Human (GRCh38)
Location 9:136149226-136149248
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353229_1062353237 10 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353224_1062353237 28 Left 1062353224 9:136149175-136149197 CCCGAGGCCTGTGCACTTCCCAG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353233_1062353237 -9 Left 1062353233 9:136149212-136149234 CCTCGGGCCTTGAGCCGTCCCCA No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353225_1062353237 27 Left 1062353225 9:136149176-136149198 CCGAGGCCTGTGCACTTCCCAGG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353223_1062353237 29 Left 1062353223 9:136149174-136149196 CCCCGAGGCCTGTGCACTTCCCA No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353227_1062353237 21 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data
1062353230_1062353237 9 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353237 Original CRISPR CCGTCCCCACAGGCAGCCCC AGG Intergenic