ID: 1062353241

View in Genome Browser
Species Human (GRCh38)
Location 9:136149235-136149257
Sequence CAGGCAGCCCCAGGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353229_1062353241 19 Left 1062353229 9:136149193-136149215 CCCAGGCTGCAGGACACAACCTC No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353233_1062353241 0 Left 1062353233 9:136149212-136149234 CCTCGGGCCTTGAGCCGTCCCCA No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353230_1062353241 18 Left 1062353230 9:136149194-136149216 CCAGGCTGCAGGACACAACCTCG No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353227_1062353241 30 Left 1062353227 9:136149182-136149204 CCTGTGCACTTCCCAGGCTGCAG No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data
1062353235_1062353241 -7 Left 1062353235 9:136149219-136149241 CCTTGAGCCGTCCCCACAGGCAG No data
Right 1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353241 Original CRISPR CAGGCAGCCCCAGGCTGAGC TGG Intergenic