ID: 1062353673

View in Genome Browser
Species Human (GRCh38)
Location 9:136151973-136151995
Sequence GGGCCTTTCCCAATATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062353673_1062353678 -2 Left 1062353673 9:136151973-136151995 CCCTGGGATATTGGGAAAGGCCC No data
Right 1062353678 9:136151994-136152016 CCCCACAGCCAGTGGCCACCTGG No data
1062353673_1062353683 14 Left 1062353673 9:136151973-136151995 CCCTGGGATATTGGGAAAGGCCC No data
Right 1062353683 9:136152010-136152032 CACCTGGCCTGCAATCTGCATGG No data
1062353673_1062353686 28 Left 1062353673 9:136151973-136151995 CCCTGGGATATTGGGAAAGGCCC No data
Right 1062353686 9:136152024-136152046 TCTGCATGGTGAAGCCACAATGG No data
1062353673_1062353675 -10 Left 1062353673 9:136151973-136151995 CCCTGGGATATTGGGAAAGGCCC No data
Right 1062353675 9:136151986-136152008 GGAAAGGCCCCCACAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062353673 Original CRISPR GGGCCTTTCCCAATATCCCA GGG (reversed) Intergenic
No off target data available for this crispr