ID: 1062354535

View in Genome Browser
Species Human (GRCh38)
Location 9:136155526-136155548
Sequence CAGTTTGAGGAGCAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062354535_1062354539 -8 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354539 9:136155541-136155563 TCAAACTGCTCCGTTAAACACGG No data
1062354535_1062354540 -7 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354540 9:136155542-136155564 CAAACTGCTCCGTTAAACACGGG No data
1062354535_1062354545 26 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354545 9:136155575-136155597 AGCCCCGAGAGAATGAAGGCAGG No data
1062354535_1062354541 -6 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354541 9:136155543-136155565 AAACTGCTCCGTTAAACACGGGG No data
1062354535_1062354544 22 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062354535 Original CRISPR CAGTTTGAGGAGCAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr