ID: 1062354538

View in Genome Browser
Species Human (GRCh38)
Location 9:136155539-136155561
Sequence GTGTTTAACGGAGCAGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062354538_1062354544 9 Left 1062354538 9:136155539-136155561 CCTCAAACTGCTCCGTTAAACAC No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data
1062354538_1062354545 13 Left 1062354538 9:136155539-136155561 CCTCAAACTGCTCCGTTAAACAC No data
Right 1062354545 9:136155575-136155597 AGCCCCGAGAGAATGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062354538 Original CRISPR GTGTTTAACGGAGCAGTTTG AGG (reversed) Intergenic
No off target data available for this crispr