ID: 1062354542

View in Genome Browser
Species Human (GRCh38)
Location 9:136155551-136155573
Sequence TGTGGTCACCCCGTGTTTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062354542_1062354552 28 Left 1062354542 9:136155551-136155573 CCGTTAAACACGGGGTGACCACA No data
Right 1062354552 9:136155602-136155624 ACAGAGACACGCCCAGCTCACGG No data
1062354542_1062354545 1 Left 1062354542 9:136155551-136155573 CCGTTAAACACGGGGTGACCACA No data
Right 1062354545 9:136155575-136155597 AGCCCCGAGAGAATGAAGGCAGG No data
1062354542_1062354544 -3 Left 1062354542 9:136155551-136155573 CCGTTAAACACGGGGTGACCACA No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062354542 Original CRISPR TGTGGTCACCCCGTGTTTAA CGG (reversed) Intergenic
No off target data available for this crispr