ID: 1062354544

View in Genome Browser
Species Human (GRCh38)
Location 9:136155571-136155593
Sequence ACACAGCCCCGAGAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062354535_1062354544 22 Left 1062354535 9:136155526-136155548 CCCAGCTCCTGCTCCTCAAACTG No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data
1062354537_1062354544 15 Left 1062354537 9:136155533-136155555 CCTGCTCCTCAAACTGCTCCGTT No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data
1062354542_1062354544 -3 Left 1062354542 9:136155551-136155573 CCGTTAAACACGGGGTGACCACA No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data
1062354538_1062354544 9 Left 1062354538 9:136155539-136155561 CCTCAAACTGCTCCGTTAAACAC No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data
1062354536_1062354544 21 Left 1062354536 9:136155527-136155549 CCAGCTCCTGCTCCTCAAACTGC No data
Right 1062354544 9:136155571-136155593 ACACAGCCCCGAGAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062354544 Original CRISPR ACACAGCCCCGAGAGAATGA AGG Intergenic
No off target data available for this crispr