ID: 1062357180

View in Genome Browser
Species Human (GRCh38)
Location 9:136170517-136170539
Sequence CTGTAGACCCAGCAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062357170_1062357180 4 Left 1062357170 9:136170490-136170512 CCGGCTGTGCCCGGGCTGAGCTC No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357169_1062357180 5 Left 1062357169 9:136170489-136170511 CCCGGCTGTGCCCGGGCTGAGCT No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357166_1062357180 19 Left 1062357166 9:136170475-136170497 CCAGCGATGGGGGACCCGGCTGT No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357163_1062357180 23 Left 1062357163 9:136170471-136170493 CCGCCCAGCGATGGGGGACCCGG No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357165_1062357180 20 Left 1062357165 9:136170474-136170496 CCCAGCGATGGGGGACCCGGCTG No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357171_1062357180 -5 Left 1062357171 9:136170499-136170521 CCCGGGCTGAGCTCCCCTCTGTA No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data
1062357172_1062357180 -6 Left 1062357172 9:136170500-136170522 CCGGGCTGAGCTCCCCTCTGTAG No data
Right 1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062357180 Original CRISPR CTGTAGACCCAGCAGGGGCA GGG Intergenic
No off target data available for this crispr