ID: 1062358220

View in Genome Browser
Species Human (GRCh38)
Location 9:136175126-136175148
Sequence GGAGAGTTTTGTGCACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062358216_1062358220 -10 Left 1062358216 9:136175113-136175135 CCTCTGCCCTAGGGGAGAGTTTT No data
Right 1062358220 9:136175126-136175148 GGAGAGTTTTGTGCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062358220 Original CRISPR GGAGAGTTTTGTGCACAGCA GGG Intergenic