ID: 1062358220 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:136175126-136175148 |
| Sequence | GGAGAGTTTTGTGCACAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062358216_1062358220 | -10 | Left | 1062358216 | 9:136175113-136175135 | CCTCTGCCCTAGGGGAGAGTTTT | No data | ||
| Right | 1062358220 | 9:136175126-136175148 | GGAGAGTTTTGTGCACAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062358220 | Original CRISPR | GGAGAGTTTTGTGCACAGCA GGG | Intergenic | ||