ID: 1062358221

View in Genome Browser
Species Human (GRCh38)
Location 9:136175133-136175155
Sequence TTTGTGCACAGCAGGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062358217_1062358221 -9 Left 1062358217 9:136175119-136175141 CCCTAGGGGAGAGTTTTGTGCAC No data
Right 1062358221 9:136175133-136175155 TTTGTGCACAGCAGGGACATTGG No data
1062358218_1062358221 -10 Left 1062358218 9:136175120-136175142 CCTAGGGGAGAGTTTTGTGCACA No data
Right 1062358221 9:136175133-136175155 TTTGTGCACAGCAGGGACATTGG No data
1062358216_1062358221 -3 Left 1062358216 9:136175113-136175135 CCTCTGCCCTAGGGGAGAGTTTT No data
Right 1062358221 9:136175133-136175155 TTTGTGCACAGCAGGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062358221 Original CRISPR TTTGTGCACAGCAGGGACAT TGG Intergenic