ID: 1062363537

View in Genome Browser
Species Human (GRCh38)
Location 9:136198476-136198498
Sequence CCCAGGGCGGGGAGGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 9, 3: 68, 4: 642}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062363523_1062363537 8 Left 1062363523 9:136198445-136198467 CCAGGGGAAAAGCAGTGGTCCGG 0: 1
1: 1
2: 1
3: 5
4: 90
Right 1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 642
1062363522_1062363537 11 Left 1062363522 9:136198442-136198464 CCACCAGGGGAAAAGCAGTGGTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 642
1062363515_1062363537 28 Left 1062363515 9:136198425-136198447 CCACAGGGATTGTGTCCCCACCA 0: 1
1: 0
2: 2
3: 23
4: 204
Right 1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 642
1062363519_1062363537 13 Left 1062363519 9:136198440-136198462 CCCCACCAGGGGAAAAGCAGTGG 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 642
1062363521_1062363537 12 Left 1062363521 9:136198441-136198463 CCCACCAGGGGAAAAGCAGTGGT 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062363537 Original CRISPR CCCAGGGCGGGGAGGGTGCT GGG Intronic
900149295 1:1171206-1171228 CCCAGGGAGGGGAGGCTGCAGGG + Intergenic
900245018 1:1632662-1632684 CCCAGGGCTGGGAGCGGGCGTGG - Intronic
900256249 1:1699821-1699843 CCCAGGGCTGGGAGCGGGCGTGG - Intronic
900482941 1:2908147-2908169 AGCAGGGCGGGGAGGGAGCTGGG - Intergenic
900676678 1:3891877-3891899 CACACGGGTGGGAGGGTGCTAGG + Intronic
900676845 1:3892475-3892497 CACACGGGTGGGAGGGTGCTAGG + Intronic
900676858 1:3892521-3892543 CACACGGGTGGGAGGGTGCTAGG + Intronic
900945375 1:5828294-5828316 AACAGGGCTGGGAGGCTGCTGGG + Intergenic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
901127365 1:6939015-6939037 CCCAGGGCGAGGACTGTGCCTGG - Intronic
901162217 1:7187128-7187150 CACAGGGCAGGGTGGGTGCGGGG + Intronic
901523770 1:9806212-9806234 CCCAGGGCAGGGGGGGTGGAGGG + Intronic
901694664 1:10997882-10997904 CCCAGGCTGAGGAGGGTGGTGGG + Intergenic
901796253 1:11681173-11681195 GCCTGGGCGGGGCGGGCGCTAGG - Exonic
901842530 1:11963239-11963261 CCCAGGGTGGGGAGTAAGCTGGG - Intronic
902035800 1:13457134-13457156 CCCTGAGCGGTCAGGGTGCTGGG - Intergenic
902348882 1:15838634-15838656 CCCAGGAGGGGGAGGTTGCAGGG + Intergenic
902375350 1:16027726-16027748 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902380314 1:16049523-16049545 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902515972 1:16989853-16989875 CGCAGGGCGGCCAGGGAGCTGGG + Intronic
903016775 1:20366648-20366670 GTCGGGGCGCGGAGGGTGCTGGG - Intergenic
903175280 1:21576657-21576679 CCCAGGGCTGGGAGGGGACAGGG + Intronic
903207917 1:21796639-21796661 CCCAGGACGTGGAGGTTGCAGGG + Intergenic
903328087 1:22582737-22582759 ACCAGGGTGCGGGGGGTGCTGGG - Intronic
903548710 1:24142951-24142973 CTCGGGCTGGGGAGGGTGCTGGG + Intronic
903854442 1:26328474-26328496 CCCAGGGCGGAGAGGGAGGCTGG + Intronic
904938572 1:34149253-34149275 CCCAGGGCGGGGAGCAGGCAGGG - Intronic
905574905 1:39036338-39036360 GCCGGGGCGGGGAGGGGGCACGG - Intergenic
905791542 1:40792198-40792220 CCCTGGGAGGGGAGGGGGCAGGG + Intronic
905797347 1:40823190-40823212 CCTAGGGCTGGGAGGGCGCAGGG - Intronic
905880100 1:41457648-41457670 CCCAGGGAGGAGAGGGAGCTGGG + Intergenic
906530731 1:46522519-46522541 TCCAGGCCGGGGAGGCTGCGTGG + Intergenic
907248025 1:53120458-53120480 CGCAGGGCAGGGAAGGAGCTGGG - Intronic
907271328 1:53293140-53293162 CCCAGGGAGGGCAGGGTTTTTGG - Intronic
907482389 1:54754212-54754234 CCGAGGGCGGGGACCTTGCTGGG + Intergenic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
908102431 1:60805292-60805314 CCAAGGGTGGGGAGGGGGCATGG + Intergenic
911015046 1:93323292-93323314 CCCAGGGCTGGGAGGCCACTCGG - Intergenic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
913558134 1:119990304-119990326 CCTAGGGCTGGGAGGGAGTTAGG + Intronic
913639708 1:120800148-120800170 CCTAGGGCTGGGAGGGAGTTAGG - Intergenic
914626859 1:149470483-149470505 CCTAGGGCTGGGAGGGAGTTAGG - Intergenic
914900244 1:151707695-151707717 CCCCGGGCTGGGAGGGAGCCAGG - Intronic
915073681 1:153292468-153292490 CCCAGGGCTGCGGGGGTGCTGGG - Intergenic
915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG + Intergenic
915106942 1:153540674-153540696 TCCAGGGCTGAGAGGGGGCTGGG + Intronic
915339312 1:155167564-155167586 CCTAGGGCGGGGAGGGGGGAAGG - Intergenic
915916060 1:159941738-159941760 CCCAGGCCTGGGAGGGGTCTCGG - Intronic
917001966 1:170370263-170370285 CCCGGGGTGGGGTGGGTCCTGGG - Intergenic
917537991 1:175888264-175888286 CCCTGGGGGAGGAGGGAGCTGGG - Intergenic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
918487495 1:185045320-185045342 CCCAGGGCGGGGCGGTGGCGCGG + Intergenic
918557260 1:185817436-185817458 CCCAGGGCGGGGTGTGTGAGGGG + Intronic
919723641 1:200866977-200866999 CGGGGGGCGGGGAGGGTGGTAGG - Intergenic
920066693 1:203274215-203274237 GGCAGAGCAGGGAGGGTGCTGGG + Intergenic
921158119 1:212453653-212453675 GCACGGGCTGGGAGGGTGCTGGG + Intergenic
921252511 1:213311034-213311056 CTCAGGGTTAGGAGGGTGCTGGG + Intergenic
922616640 1:226964835-226964857 CCCAGGCTGGGAAGGGTGCCGGG + Intronic
922720904 1:227899889-227899911 TCCAGGGCGGAGAATGTGCTTGG + Intergenic
922796150 1:228340850-228340872 CCCAGGGCCTGCAGGGTGCCTGG - Exonic
922925278 1:229342625-229342647 GCGAGGGCGGGGAGGGGGCGGGG + Intronic
923049628 1:230381702-230381724 CCCTGGGCGTGGAGGGTGGCTGG - Intronic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
1063004170 10:1952623-1952645 CAGAGGCCGGGGAGGGTGCTGGG - Intergenic
1063429560 10:5977247-5977269 CCCAGGCCGGGGAGGGGACGCGG - Intronic
1064052315 10:12069183-12069205 CCCAGGTCGGGGATGGGGCCCGG + Exonic
1064262064 10:13793955-13793977 CTCAGGGTAGTGAGGGTGCTGGG + Intronic
1065844947 10:29736376-29736398 CCCAGGGCTGGGAAGATGCTTGG + Intronic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1067806186 10:49395183-49395205 GCCCAGGCGGGGAGGGAGCTGGG + Intronic
1069567819 10:69475125-69475147 ACCAGGGGGAGGAGGGTGTTGGG + Intronic
1069626888 10:69873694-69873716 CCCAGGCCAGGGCGGGTGGTCGG - Intronic
1069874247 10:71551945-71551967 CCCTGAGAGGGGAGGGTGCCCGG - Intronic
1069928146 10:71865507-71865529 CCCATGGCGGGGGTGGGGCTGGG - Intergenic
1070314295 10:75295396-75295418 GCCAGGGAGGGGCGGGAGCTGGG + Intergenic
1070794117 10:79207141-79207163 GCCAGGGCAGGGAGGGGCCTAGG - Intronic
1070967900 10:80540837-80540859 CCCAGGGCGGGAATTGTGCGGGG + Intronic
1072541134 10:96398661-96398683 CCCAGGGCGAGGTGGGAGATGGG + Intronic
1072547177 10:96448746-96448768 CCCTGGGGTGGGAGTGTGCTTGG + Intronic
1072609164 10:97005042-97005064 TCCAGGCAGGGGAGGGTGATGGG + Intronic
1072619764 10:97072096-97072118 CACAGGCCGGGGAGAGTGATGGG + Intronic
1072938168 10:99732809-99732831 GCCACGGCGGGGACGGGGCTTGG + Intronic
1073134659 10:101213838-101213860 CCCATGCCGCGGAGGGTGCGAGG + Intergenic
1073178561 10:101570561-101570583 CCCAGAGGGTGGAGGGTGTTAGG + Intronic
1074077657 10:110143333-110143355 CCCAGGTGGAGAAGGGTGCTTGG - Intergenic
1074165792 10:110872452-110872474 CCCAGGGAGGGCAGGGGGCGGGG - Intronic
1074393184 10:113074867-113074889 CACAGGGCAGGGATGCTGCTAGG + Intronic
1074766478 10:116703768-116703790 CCCGGGGCCTGCAGGGTGCTGGG + Intronic
1075105307 10:119536388-119536410 CCCTGGGCGGGGCAGGGGCTGGG - Intronic
1075446844 10:122519198-122519220 CACGGGGCAGGGAGGGTACTAGG - Intergenic
1075627470 10:123973041-123973063 GCCAGGCCGGGGCGGGTGATGGG + Intergenic
1075664003 10:124218004-124218026 ACCAGGGAGGGGAGGAGGCTAGG - Intergenic
1075686699 10:124369337-124369359 CCCAGGGCAGTGAGGGGGATTGG + Intergenic
1075806081 10:125189701-125189723 CCCAGGGGAGGGAGGGAGCTTGG + Intergenic
1076369154 10:129940742-129940764 CCCTGGGTGGGGAGGGGGCCTGG - Intronic
1076424730 10:130359419-130359441 CGCTGGGCGGGCAAGGTGCTTGG - Intergenic
1076499417 10:130924550-130924572 CCCACGGAGGGCTGGGTGCTGGG - Intergenic
1076507609 10:130988131-130988153 TCCAGGGCCGGGAGGGTGGTAGG - Intergenic
1076540904 10:131214174-131214196 CCCAGGGAGGGGTGGGAGCCTGG + Intronic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076700316 10:132269580-132269602 CCAAGGGCAGGAAGGCTGCTCGG + Intronic
1076830754 10:132993010-132993032 CCGGGGGCGGGGCTGGTGCTGGG - Intergenic
1076855704 10:133114779-133114801 CCCAGGGCAGTGAAGGTGCCGGG + Intronic
1077028845 11:454283-454305 CCCAGGGCCAGGAGGGTGCTGGG + Intronic
1077168145 11:1152929-1152951 CCCAGGGCGGGGACAGTGCCGGG - Intergenic
1077194834 11:1274134-1274156 CCCAGTGGGGAGAGGGTGCCTGG + Intergenic
1077311654 11:1891493-1891515 CCCAGGGTGGGCAGGCTGCTTGG + Intronic
1077316204 11:1920471-1920493 TCCAGGGCAGGGAGGGTGGGTGG - Intronic
1077331623 11:1986560-1986582 CGGGGGGCGGGGAGGGTGTTTGG - Intergenic
1077437645 11:2550496-2550518 CCCAGGGCGGGCAGTGCCCTTGG - Intronic
1077494886 11:2882162-2882184 GGCTGGGCGGGGAGGGTGATGGG - Intergenic
1077543765 11:3160029-3160051 GCCAGGGCAGGGAGGGGGCTGGG - Intronic
1077575568 11:3380376-3380398 CCCAGGGCAGATAGGGTGCCAGG - Intergenic
1077837510 11:5937628-5937650 ACCAGGGCGGAGAGGGTCGTAGG - Intronic
1078577182 11:12512445-12512467 CCTGGGGCTGGGAGGGTGCGAGG - Intronic
1079396470 11:20067904-20067926 CCCCAGGCGGGGATGGTGATAGG - Intronic
1080361359 11:31517690-31517712 CCCAGGAGGGGGAGGTTGCAGGG - Intronic
1080812112 11:35715195-35715217 CCCTGGGAGGAGAGGATGCTTGG + Intronic
1081814634 11:45931703-45931725 CCCAGGGCCTGGAGTGGGCTTGG + Intronic
1082706301 11:56497495-56497517 TCCCGGGCGGGGTGGCTGCTGGG - Intergenic
1083335094 11:61917536-61917558 CCCAGGGCAGGGTCGGGGCTGGG - Intronic
1083685841 11:64374605-64374627 CCCAGAGAAGGGAGGATGCTGGG + Intergenic
1084097386 11:66920639-66920661 GTCAAGGCGGGGAGGCTGCTTGG - Intronic
1084174337 11:67415768-67415790 CCCGGGGCGGGGCCGGAGCTGGG - Intronic
1084433301 11:69123353-69123375 GTGAGGGCGGGGAGGGGGCTGGG + Intergenic
1084575352 11:69985334-69985356 CCCGGGGAGGGGAGGGGGGTGGG + Intergenic
1084717475 11:70883077-70883099 CCCAGGGTGGGGATGCAGCTGGG - Intronic
1084955407 11:72688709-72688731 CCTAGGGCTGGGAGGTTGGTTGG - Intronic
1085308152 11:75500107-75500129 CCAGGGGCAGGGAGGGTGCCTGG - Intronic
1085401681 11:76239516-76239538 CCCAGGGCGAGGAGCAGGCTGGG + Intergenic
1087064335 11:94012861-94012883 AGCAGGGCAGGGAGAGTGCTGGG + Intergenic
1087290669 11:96316959-96316981 ACCAGAGTGGGGAGGGGGCTTGG - Intronic
1089100450 11:115958436-115958458 CCCAGGGAGGGGAGGGACATCGG - Intergenic
1089196533 11:116696783-116696805 TGCAGGGCGGGGATGGTGCGGGG - Intergenic
1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG + Intronic
1089774709 11:120828164-120828186 CCCAGTGCAGGCAGGGTGCATGG - Intronic
1090313513 11:125764461-125764483 CCCAGGGAGGGCAGTGAGCTAGG + Intergenic
1090348000 11:126086392-126086414 CCTGAGGCGGGGAGGGAGCTGGG + Intergenic
1090646806 11:128773004-128773026 CCCAGGGCTGGGAGGAAGCTTGG + Intronic
1091262502 11:134245594-134245616 CCCAGGGCCGAGAAGATGCTGGG + Exonic
1091300422 11:134503817-134503839 TCCAGGGAGGGGAGGATGCAGGG - Intergenic
1091358885 11:134958574-134958596 CCGAGGGCTGGGATGGGGCTAGG + Intergenic
1202814604 11_KI270721v1_random:41736-41758 CGGGGGGCGGGGAGGGTGTTTGG - Intergenic
1091601882 12:1922640-1922662 CCCAGGGCAGGGAGAGCACTCGG + Intergenic
1091805746 12:3354775-3354797 CCCAAGCCTGGGAGGCTGCTGGG - Intergenic
1095875993 12:47080123-47080145 CGCAGAGCGGGGAGGGGGCAGGG + Intronic
1096649279 12:53054010-53054032 CCCAGGTAAGTGAGGGTGCTGGG + Exonic
1096660147 12:53119109-53119131 CCCAGGGCCTGGAGGGGGCATGG - Exonic
1096987709 12:55772297-55772319 TCTAGGGCTGGTAGGGTGCTAGG + Intronic
1096990863 12:55801691-55801713 CCCAGGAGGGGGAGGCTGCAGGG - Intronic
1097250347 12:57629034-57629056 CCCAGGGAGGTGAGGCTGGTAGG - Exonic
1098897831 12:76084021-76084043 CCCGAGGCGGGGAGGGGGCGGGG - Intronic
1099439820 12:82686768-82686790 TCCAGGCCGGGGAGGGTGGGAGG + Intergenic
1099574430 12:84362287-84362309 CCCAGGGCAGGGCGGGTGGCAGG - Intergenic
1101658205 12:106742953-106742975 CACAGGACAGGAAGGGTGCTCGG - Intronic
1102028151 12:109725151-109725173 CCCAGAGCTGGGAAGGAGCTTGG + Intronic
1102216355 12:111164227-111164249 ACCAGGCCTGGAAGGGTGCTGGG - Intronic
1102223383 12:111210039-111210061 CCCAGGGCTGGGGGGCTGGTGGG + Intronic
1102424103 12:112827210-112827232 CCCAGGCTGGGGGAGGTGCTGGG - Intronic
1102957147 12:117066137-117066159 CCTAGGGAGGAGAGGGTCCTTGG - Intronic
1103309203 12:119990340-119990362 CCCAGGGCCGGGCGCGTGCCTGG - Intronic
1103713391 12:122929344-122929366 GCCAGGGCGGGTAGGGAGCGTGG - Exonic
1103913384 12:124363847-124363869 CCCAGGGTGGGGGGGCTGCCCGG + Intronic
1103983176 12:124750036-124750058 AGCGGGGCGGGGAGGGGGCTTGG + Intergenic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104723257 12:131058326-131058348 CCCAGGGCGGGTCGGCTGCTTGG + Intronic
1104844175 12:131838558-131838580 CCTAGGGTGGGGAGTGAGCTGGG + Intronic
1104892840 12:132148666-132148688 GCCAGGCCGGGGAGGGGGCGGGG + Intronic
1104897052 12:132169483-132169505 CCCAGGGCGGGGACGCTGAGGGG + Intergenic
1105699580 13:22926360-22926382 GCCGGGGCGGGGCGGGTGGTGGG + Intergenic
1108176098 13:47794431-47794453 GCCAGTGCAGGGAAGGTGCTGGG - Intergenic
1108340665 13:49496020-49496042 CCCCGGCCCGAGAGGGTGCTCGG + Exonic
1112461378 13:99606509-99606531 CGCGGGGCGGAGCGGGTGCTGGG + Intergenic
1113227516 13:108175796-108175818 CCGAGGGCTGGGAGGGTTGTGGG - Intergenic
1113822656 13:113226103-113226125 GCCAGGGAGGGTAGGGTGCCAGG - Intronic
1113841616 13:113364287-113364309 CCCAGGGCGGGGGAGGGGCGGGG + Intergenic
1113841668 13:113364393-113364415 CCCAGGGCGGGGGAGGGGCGGGG + Intergenic
1113979167 13:114258308-114258330 CCCAGGGCTGGGAGAAAGCTGGG + Intronic
1114952512 14:27773638-27773660 CTCAGAGCGGGGAGGGTGATGGG - Intergenic
1116972572 14:51081955-51081977 CCCAGGGCAGGGAGGGTGGCTGG - Intronic
1117342693 14:54805559-54805581 TCCAGGCTGGGGAGAGTGCTGGG - Intergenic
1117411688 14:55456389-55456411 TCCAGGACGGGGTGGCTGCTGGG + Intronic
1119134275 14:72202719-72202741 CCCTTGGAGGGGAGGGTCCTGGG + Intronic
1119338111 14:73851794-73851816 CCCTGGGAGGGGAGGGGGCGCGG + Intergenic
1119824003 14:77642009-77642031 CCAAGGGCGGGGAGGATGCGCGG + Intergenic
1120781967 14:88493531-88493553 CCCAGGACGGGGCGGGTGAGAGG + Intronic
1121234284 14:92380750-92380772 CCCATGGCATGGAGGGTGCCAGG + Intronic
1121741672 14:96257187-96257209 CCCAGGACGGGGAGGTGGCTGGG - Intronic
1121820523 14:96962181-96962203 CCCAGCCCTGGGAGGGTGTTAGG - Intergenic
1121866094 14:97364124-97364146 CCCAAGGTGGGGAGGGCCCTAGG + Intergenic
1122145116 14:99684278-99684300 GAGCGGGCGGGGAGGGTGCTGGG + Intergenic
1122238228 14:100344921-100344943 TCCAGGACGGGGTGGCTGCTGGG - Intronic
1122271830 14:100571739-100571761 CCTAGCGAGGGGAGGCTGCTGGG - Intronic
1122577816 14:102752811-102752833 CCCAGGGCAGGGCGGGGGCAGGG - Intergenic
1122594363 14:102879012-102879034 CCCAGTGAGTGGAGGGTGATGGG + Intronic
1122619297 14:103045449-103045471 CTCGGGGCTGGGAGGGTGCAGGG - Intronic
1122904402 14:104795320-104795342 GCCTGGGCGGGGAGGGCGCGGGG - Intronic
1122931730 14:104936219-104936241 CCCAGGGGGAGGAGTCTGCTTGG - Exonic
1122978491 14:105180926-105180948 CCCAGGCCGGGGAGGGGCCGCGG - Intronic
1123103010 14:105818465-105818487 CGCAGGGTGGGGAGTTTGCTGGG + Intergenic
1123129251 14:105972342-105972364 CCCAGGGCGGGGCAGGGGGTGGG + Intergenic
1123630266 15:22256275-22256297 CCCAAGGTGTGGAGGGGGCTGGG + Intergenic
1124342848 15:28901290-28901312 CCCAGAGCTGGGTGGGGGCTGGG - Intronic
1124607135 15:31178169-31178191 CCCAGGGCGGGGAGTGGGGGAGG - Intergenic
1125513754 15:40306802-40306824 TTCAGGGAGGGGAGGCTGCTGGG - Intronic
1125535801 15:40440849-40440871 CGCAGGGCGGGGCGGCTGATTGG + Intronic
1125749412 15:42018715-42018737 TCCAGGCTGGGGAGGGGGCTGGG - Intronic
1126113408 15:45188030-45188052 CGCCGGGCGGGGAGGGGGCGGGG + Intronic
1126137020 15:45402526-45402548 CCCAGGGCGTGGAGGGCGGCCGG - Exonic
1127588165 15:60397706-60397728 CCTCGGGCCGGGAGGGTGCAGGG - Intronic
1127611466 15:60641483-60641505 CCCAGGACGCGGAGGTTGCAGGG - Intronic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1128309627 15:66622176-66622198 CCCACGGCCGGGAGGGCGCAGGG - Intronic
1128530262 15:68440297-68440319 CCCTTGGAGGGGAGGGAGCTGGG - Intergenic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1128709075 15:69858408-69858430 CCCTGGGAGGGGTGGGAGCTGGG + Intergenic
1129271695 15:74422388-74422410 CTCAGGTAGGGGAGGGGGCTAGG + Intronic
1129350886 15:74955489-74955511 CCCAGGGCGGGGAGCGGAATAGG + Exonic
1129709600 15:77813877-77813899 GGCAGGGTGGGGAGGGCGCTGGG - Intronic
1129915404 15:79265734-79265756 CTCAGGACTGGGAGGGTTCTTGG + Intergenic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1130997768 15:88913246-88913268 CCCAGGGCGACGAGGAGGCTGGG + Exonic
1131115404 15:89792261-89792283 CCCAGGGCGGGGAGGAGGAGTGG - Exonic
1132163918 15:99566311-99566333 GGCGGGGCGGGTAGGGTGCTGGG + Intronic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132549776 16:549557-549579 CCCAGGGCGGGTAGTGTGGGGGG + Intronic
1132549880 16:549988-550010 CCCAGGGAGGGGGAGGTGATTGG - Intronic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132724048 16:1331198-1331220 CTCAGGGTGGGGAGGGTGGGCGG + Intergenic
1132826428 16:1907719-1907741 CCCAGGGGAGGGAGGGAGCCAGG + Intergenic
1133018198 16:2954719-2954741 CCCAGGTCAGGGAGGGAGTTTGG - Intergenic
1133076731 16:3285782-3285804 CTCAGGGGAGGAAGGGTGCTGGG - Intronic
1133233167 16:4375915-4375937 CCCAGAGAGGGGAGCTTGCTTGG + Intronic
1133333994 16:4994919-4994941 CCCGGGGCCGGAAGGATGCTGGG + Intronic
1134005912 16:10818688-10818710 CGCAGGCTGGGGAGGGGGCTCGG + Exonic
1136289693 16:29264198-29264220 CGGAGGGCAGGGAGGGTGCATGG - Intergenic
1136316581 16:29458041-29458063 CCCAGGGCAGGGAGTGGGGTAGG - Intronic
1136377254 16:29872779-29872801 GCCAGGGAGGGGAGGAGGCTGGG + Intronic
1136431157 16:30197383-30197405 CCCAGGGCAGGGAGTGGGGTAGG - Intronic
1137693647 16:50447001-50447023 CCCAGGGAGGTGAGGCAGCTGGG - Intergenic
1137701942 16:50503694-50503716 CCCAGGGAGGGGCGGGTGCCAGG + Intergenic
1138079126 16:54072093-54072115 CCCAGGGCCAGGAGGCTGCTGGG + Intronic
1138327930 16:56191198-56191220 CCGCGGGCCGGGAGGGCGCTGGG + Intergenic
1138327953 16:56191298-56191320 CCCGGGACGGGGAGGGCGCGGGG - Intergenic
1139956190 16:70694101-70694123 CTCAGGGCTGGGACGGTGTTGGG + Intronic
1139959551 16:70709884-70709906 CCCAGGGCAGGTAGGGTTCAGGG - Intronic
1140258644 16:73358183-73358205 GCCAGGGAGTGGACGGTGCTGGG - Intergenic
1141033716 16:80610916-80610938 GGCATGCCGGGGAGGGTGCTGGG - Intronic
1141184690 16:81779136-81779158 TCCATGGCGGGGAGGGCGCGGGG + Intronic
1141378254 16:83551476-83551498 CCCAAGGCTGGGAAGGTACTAGG - Intronic
1141424386 16:83935763-83935785 CCCAGGGAGAGGAGGCGGCTGGG + Intronic
1141469998 16:84231583-84231605 CCCAGGGCTGGAAGGGCACTAGG + Intronic
1141600002 16:85119954-85119976 GTCAGGGCTGGGAGGGCGCTAGG - Intergenic
1141825191 16:86473677-86473699 CCCATGGCGGGCTGGGTGTTGGG + Intergenic
1141828124 16:86494995-86495017 CCGAGGGCGCGGAGGGAGCGGGG + Intergenic
1141972820 16:87494368-87494390 CCCAAGGTGTGGAGGGGGCTGGG - Intergenic
1142004952 16:87685290-87685312 CCCAAGGCGGTGGGGGTGCGGGG - Intronic
1142095446 16:88237240-88237262 CGGAGGGCAGGGAGGGTGCGTGG - Intergenic
1142095527 16:88237519-88237541 CGGAGGGCAGGGAGGGTGCGTGG - Intergenic
1142309176 16:89302202-89302224 CCCTGGGCCGGGAGGCTGCTGGG - Intronic
1143544780 17:7589569-7589591 CCCAGGAGCGGGAGGGCGCTGGG - Exonic
1143747855 17:9006452-9006474 CCCAGTGCAGGGAGGGGCCTTGG + Intergenic
1143786664 17:9260756-9260778 TCCAGGGTGAGGAGGGTGCCAGG - Intronic
1143811308 17:9473982-9474004 CCCAGGGAGGGGAGGGAGGCTGG + Intronic
1143868778 17:9943092-9943114 CCCAGGGCTGGGAGGGGCCCAGG + Intronic
1144208143 17:12993643-12993665 CACAGGGCGGGGACGGGGCAGGG - Intronic
1144411527 17:15006485-15006507 CCCAGGGCGGGGATAGGGGTAGG + Intergenic
1144573601 17:16415798-16415820 GCCAGGGCGTGGCGGCTGCTGGG - Exonic
1144764480 17:17725116-17725138 GCCGGGGCAGGGAGGGGGCTGGG + Intronic
1145414601 17:22704194-22704216 ACCGGTGAGGGGAGGGTGCTTGG + Intergenic
1145750730 17:27353660-27353682 CCCACGGCGGGGAGGAGGCTGGG - Intergenic
1146201322 17:30861195-30861217 CCAAGGGCGGGGAGGGGGGTGGG - Intronic
1147169662 17:38610575-38610597 CCCAGAGTGAGGTGGGTGCTAGG - Intergenic
1147669826 17:42170581-42170603 ACCAGGGCAGGGAGAGTGTTTGG - Intronic
1147897153 17:43758278-43758300 CCCAGGGCAGGGAGGACGCTGGG - Intronic
1147973892 17:44236774-44236796 CCCAGGGCTGGCAGGCTGCAGGG - Intergenic
1148154266 17:45413699-45413721 TCCAGGGCGGGGTGGGAGCTGGG + Intronic
1148412048 17:47475924-47475946 CCCAGGAGGCGGAGGTTGCTAGG + Intergenic
1148691293 17:49528446-49528468 CCCTGTGCGTGGAGGGGGCTGGG - Intergenic
1148791912 17:50178023-50178045 GCCAGGGCTGGGAGAGTGCAAGG + Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148836724 17:50469466-50469488 CCGAGGGTGGGGAAGGAGCTCGG - Intronic
1148853276 17:50565049-50565071 GGCAGGGCGGGGTGAGTGCTGGG - Intronic
1149546846 17:57510220-57510242 CCTTGGGTGGGGAGGGTGCCTGG + Intronic
1149614819 17:57988445-57988467 CCCGGGGCGGGGATGGGGCGCGG + Intergenic
1149655660 17:58308516-58308538 CCCAGGGCGGGGAGTGAGCACGG + Intronic
1149703785 17:58677041-58677063 CTCAGGAGGTGGAGGGTGCTGGG + Intronic
1150294100 17:63998691-63998713 CCCAGGGCTGGGGGTGTGCGCGG - Exonic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151362190 17:73595654-73595676 CCCAGGGCAGGCAGGAAGCTGGG + Intronic
1151448314 17:74181602-74181624 CCCAGGGTGGGGAGGGGGCTTGG - Intergenic
1151680648 17:75621026-75621048 CCAAGGGTGGGCAGGGCGCTGGG - Intergenic
1152245425 17:79182708-79182730 CTCTGGCCGGGGAGGGGGCTGGG - Intronic
1152281107 17:79385276-79385298 AGCAGGGCGGGGAGGCTGCAAGG + Intronic
1152305386 17:79517367-79517389 CCCAGGGGGCGGAGGTTGCAGGG + Intergenic
1152389512 17:79994276-79994298 CTCAGGGCCGGGGGGGTGCCAGG + Intronic
1152433275 17:80260926-80260948 CCCGGGGCGGGGAGCGGGCTAGG + Intronic
1152436164 17:80277812-80277834 ACCATGGTGAGGAGGGTGCTAGG + Intronic
1152583945 17:81180914-81180936 CCCAGGGGGGGTTGGGTTCTGGG - Intergenic
1152597254 17:81243833-81243855 CCAGGGGCTGGGAGGGGGCTGGG - Intergenic
1152617822 17:81345983-81346005 CCCGGGGCGGGAGGGGTGCAGGG + Intergenic
1152645006 17:81464820-81464842 GCCAGGGCGGCGAGGGTGAGGGG - Exonic
1153428557 18:4991316-4991338 ACAAGGGAGGGGAAGGTGCTTGG + Intergenic
1153804987 18:8703999-8704021 CCCTGGGCGGGGAGGCAGGTAGG - Intergenic
1155838529 18:30618744-30618766 CCCAGGGTAGGGAGAGAGCTGGG - Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1157449975 18:47778770-47778792 CCTAGGGCTGGGAGGGTGGAGGG + Intergenic
1157609662 18:48948743-48948765 CCGAGGACGGGGAGGGGGCATGG - Intronic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1159941391 18:74411682-74411704 GCCAGGGCGGGGAGGGGGATGGG - Intergenic
1160027314 18:75229090-75229112 CCCTGGGCGGGGCAGGTGTTGGG + Intronic
1160052167 18:75444054-75444076 ACTAGGGTGGGGAGGCTGCTTGG - Intergenic
1160172464 18:76566544-76566566 CGGAGGACGGGGAGAGTGCTGGG + Intergenic
1160201761 18:76801945-76801967 GCCAGGGCGAGCAGGGTGCGGGG + Intronic
1160718455 19:587024-587046 CTCAGGGTGGGGAGGGGGCCAGG - Intergenic
1160722735 19:604517-604539 GGCAGGGCTGTGAGGGTGCTGGG + Intronic
1160848926 19:1180439-1180461 CCCAGGGAGGGGGAGGTGCGTGG + Intronic
1160951950 19:1672045-1672067 CACAGGGAGGGGAGGGGTCTGGG - Intergenic
1160989674 19:1855412-1855434 CACAGGGAGGGGAGGGGGCGGGG + Intronic
1161167505 19:2796292-2796314 CGCAGGGCAGGGGGAGTGCTGGG + Intronic
1161207204 19:3047276-3047298 GCCGCGGCGGGGAGGGGGCTCGG + Intronic
1161252108 19:3285856-3285878 CGCTGGGCGGGGAGGGGGCGGGG - Intronic
1161321560 19:3643933-3643955 CCCAGGGAGTGGGGGCTGCTGGG - Intronic
1161395650 19:4043693-4043715 CCCAGGGGGTGGAGGGGGCCAGG - Intergenic
1161397577 19:4052612-4052634 CCCAGGGCGGGCGGGGGGCAGGG + Intronic
1161399567 19:4061368-4061390 CGCTGGGCGGGGAGGGGGCGGGG - Intronic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1161993122 19:7696650-7696672 CGCAGGGTGGGGAGTGTGCTTGG - Intronic
1162029832 19:7912573-7912595 CCCGGGGCGGGGGGGGTGGGTGG - Exonic
1162123758 19:8488126-8488148 CCCAGGGCAGGTAGGGTGGAGGG - Intronic
1162125715 19:8498581-8498603 CCCAGGGCTGAGCGGGTGCCGGG + Exonic
1162398306 19:10430674-10430696 CCCAGGGCGGGGCGGGTCTGGGG - Intronic
1162416794 19:10543541-10543563 CCCAGGCCAGGGCGGGTTCTGGG + Intergenic
1162524226 19:11197880-11197902 CCCAGCTCGGGGAGGGCGCGCGG + Intergenic
1162806732 19:13141009-13141031 CCCAGGGAGGGGTGGGGGCTCGG - Exonic
1162927679 19:13938349-13938371 CCCAGGGCGGGGAAGGGGGTGGG - Exonic
1163127449 19:15251867-15251889 CCCAAGGTGGGGAGGGCGCCTGG + Intronic
1163420631 19:17211936-17211958 GCCACGGTGGGGAGGGGGCTCGG - Exonic
1163578308 19:18123394-18123416 CCCAGGGAGGGGCCGGGGCTGGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1163633400 19:18428012-18428034 TCCAGGGCGGGAGGTGTGCTGGG + Intronic
1163714966 19:18868249-18868271 TGCAGGGGGTGGAGGGTGCTGGG + Intergenic
1164443755 19:28299916-28299938 CCCAGGTGTGGGAGGCTGCTGGG + Intergenic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1164682741 19:30146330-30146352 GCCAGGGCGGGGCAGGGGCTGGG + Intergenic
1164760227 19:30722978-30723000 CCCAGGGCCTGGAGGGTGGTGGG + Intergenic
1164792873 19:31002916-31002938 TCCAGGGCTGGGAGGGTGCCAGG + Intergenic
1165549736 19:36573668-36573690 CCCGGGCCGGGGAGGGTGAAGGG + Intronic
1165861662 19:38912254-38912276 CCGCGGGCGGGGAGGGGGCGGGG - Intergenic
1166042899 19:40214004-40214026 GCGCGGGCGGGGAGGGTGGTGGG - Exonic
1166284110 19:41813127-41813149 CTCAGGACCTGGAGGGTGCTGGG - Intergenic
1166409790 19:42548849-42548871 CTCAGGACCTGGAGGGTGCTGGG + Intronic
1166547025 19:43639870-43639892 CCCCGGGCGGGCAGGGGGCGGGG - Intergenic
1166871340 19:45872790-45872812 CCCAGGGCGGGGAAGATGTGGGG + Exonic
1166930064 19:46297018-46297040 GCAAGGCCGGGGAGGGGGCTAGG + Intergenic
1167144344 19:47672947-47672969 CCAAGGAAGGGGAGGGTGGTGGG - Intronic
1167254649 19:48419826-48419848 CCCAGGGCTGGGCTGGAGCTGGG + Intronic
1167361244 19:49031721-49031743 CTCAGGGAGGGGAGGGTTCGAGG - Intronic
1167424495 19:49423168-49423190 CCCAGGGAGGGGTGGGAACTTGG - Intronic
1167798559 19:51726391-51726413 AGCAGGGCGGGGTGGGGGCTGGG - Intergenic
1168410053 19:56134165-56134187 CCCAGGGCAGGGATGGGGTTTGG - Intronic
1168643470 19:58045039-58045061 CCGGGGGCAGAGAGGGTGCTGGG + Intronic
925183876 2:1833972-1833994 CCCGGGGCCGGGAGTGGGCTGGG + Intronic
925367551 2:3321103-3321125 CCCTGGGCCGGGAGGCTGCGTGG - Intronic
927142287 2:20138722-20138744 CCCAGGACGGGGAAGGCGCCCGG + Intergenic
927818917 2:26245075-26245097 CCCAGGGAGGGGAGGGGGCCGGG - Intronic
928194963 2:29209050-29209072 CCCAGGTCGGGCAGGATGCAGGG - Intronic
928904830 2:36357009-36357031 GCCAGTGCGGGGAGGGCGGTAGG - Intronic
929153954 2:38772985-38773007 CCCAGGAGGGGTAGGGTGCAAGG - Intronic
930495334 2:52134578-52134600 CCCAGTGCAGGGAGGGAGGTGGG - Intergenic
930799297 2:55425940-55425962 CCCTGGGCAGGGAGGGGGCATGG + Intergenic
931107006 2:59067199-59067221 CCCACGGCGGGGAGGAGGCTCGG - Intergenic
932624195 2:73284685-73284707 CCCAGGGCGGGGAATGCACTGGG - Intergenic
933078145 2:77954960-77954982 CTCAGGGAGGCGAGGGTGCGAGG - Intergenic
933524329 2:83416493-83416515 GCCAGGGCAGGGAGGGAGCAGGG + Intergenic
933559671 2:83874687-83874709 ACCAGGGCGGAGAGGGTCGTAGG + Intergenic
933719882 2:85391108-85391130 CCCATGCCGGTGAGGGTACTTGG - Exonic
934484795 2:94695644-94695666 CTCAGAGCGGGGAGGGTGACAGG + Intergenic
934576632 2:95405848-95405870 CCCAGAGCGGGGAGGGTGCAGGG - Intronic
934638854 2:96014016-96014038 CCCAGAGCGGGGAGGATGTGGGG - Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934761739 2:96860487-96860509 CTCATGGCCGGGTGGGTGCTGGG + Exonic
934794797 2:97091395-97091417 CCCAGAGCGGGGAGGGTGCAGGG + Intronic
934853604 2:97716050-97716072 CCCAGGCTGGGGAGGGGGCAGGG + Intronic
934943104 2:98516514-98516536 CCCAGGGCTGGCAGGATGTTGGG + Intronic
936287679 2:111193345-111193367 CCCAGAGCTGGGAGGGTGGGTGG + Intergenic
936510036 2:113137842-113137864 CCTAGGGAGGAGAGGTTGCTTGG - Intergenic
936547623 2:113406315-113406337 TTCAGGGCAGGGAGGGGGCTGGG - Intergenic
937972902 2:127564319-127564341 CACAGGGCGGGGAGGGCTCCAGG - Intronic
938100279 2:128493491-128493513 CCGCGGGCGGGGAGGGGGCGGGG - Intergenic
938108587 2:128549768-128549790 CCCAGGGTGGGGTGGGTGCAAGG - Intergenic
938201624 2:129377219-129377241 CCCAGGGTTGGCAGGGGGCTCGG - Intergenic
938251133 2:129816743-129816765 TCCAGGGCCTGGAGGCTGCTGGG - Intergenic
938262187 2:129903983-129904005 CCCAGGGCAGCGAGGGTGCCTGG + Intergenic
938292520 2:130157629-130157651 CCCAGGGCTGTGTGGGCGCTGGG - Intronic
940645530 2:156388853-156388875 CCCAGGAGGCGGAGGTTGCTGGG - Intergenic
940883418 2:158968869-158968891 CCCGGGGTGGAGAGGGTGATGGG + Intronic
941476089 2:165953596-165953618 CCGGGGGCGCGGAGGGAGCTCGG - Intronic
942326533 2:174781229-174781251 CCTAGGGCCGGGAGGGCTCTGGG + Intergenic
943033744 2:182716006-182716028 CCGCGGGCGGGGAGGGTGGATGG - Intergenic
944856722 2:203775331-203775353 CCAAAGCCGGGGAGGGTGCTAGG - Intergenic
945955404 2:216081851-216081873 GCCGGGCCGGGGAGGGTGCGGGG - Exonic
946131481 2:217610222-217610244 CTCAGGGCTGGGAGGGCTCTGGG - Intronic
946168929 2:217882267-217882289 ACCAGGGGTGGAAGGGTGCTGGG + Intronic
947611967 2:231530266-231530288 CCTAGGGCGGGAAGGGTCCGAGG - Intronic
947791268 2:232870729-232870751 CCCAGGTCTGGGAGGCAGCTGGG + Intronic
948317602 2:237040716-237040738 CCCTGGGAGGGGAGCGTGTTGGG + Intergenic
948370921 2:237488517-237488539 TCCTGGGCAGGGAGGGGGCTGGG - Intronic
948427381 2:237896392-237896414 CCCAGGCCGGGGAGGAATCTGGG - Intronic
948453662 2:238093967-238093989 ACCAGGAGGGGGAGGGTGCGTGG + Intronic
948464172 2:238144349-238144371 AGGAGGGCAGGGAGGGTGCTCGG + Intronic
948599884 2:239101934-239101956 CCCTGGGCGGGGAGCGTCCAGGG - Intronic
948623147 2:239249307-239249329 CCCAGGGCGGGGAGGGGCTGCGG + Intronic
948787959 2:240362885-240362907 CCCAGGGCTGGGCAGGTGGTCGG - Intergenic
948921407 2:241067668-241067690 ACCAGGCTTGGGAGGGTGCTGGG - Intronic
949047073 2:241877093-241877115 CCCAGGGCAGGGAGGTCGCAGGG + Intergenic
1168894320 20:1313160-1313182 ACCCGGGCGGGGCTGGTGCTGGG - Intronic
1168997798 20:2145835-2145857 GCCAGGGAGAGGGGGGTGCTGGG - Exonic
1170358249 20:15516534-15516556 CCCAGGGCAGTGCGGGTGCTGGG + Intronic
1170590179 20:17765722-17765744 CCCGTGGAGGGGAGGGTGGTGGG - Intergenic
1171811377 20:29746105-29746127 CCTACGGCGGGGAGGGGGGTTGG + Intergenic
1172421859 20:34825198-34825220 GGCTGGGTGGGGAGGGTGCTGGG - Intronic
1172587025 20:36092409-36092431 CCCAGCGCCGGGAGGGTTCGCGG + Intronic
1174280652 20:49436663-49436685 CCCAGGGCTGGGATGGAGGTGGG + Intronic
1174379379 20:50146873-50146895 CCCAGGCTGGGGCGGCTGCTGGG - Intronic
1174387206 20:50194230-50194252 CCCAGGGCTGGGAGGGGACGTGG - Intergenic
1174576725 20:51542504-51542526 CGCAGGGCGGGAAGGCTGCGGGG + Exonic
1175429596 20:58891935-58891957 CCCGGGGCGGGGGGCGGGCTCGG - Intronic
1175527679 20:59646748-59646770 CCTGAGGCAGGGAGGGTGCTGGG + Intronic
1175805011 20:61822562-61822584 GGCAGGGAGGGGAGGGTGCCAGG + Intronic
1175879144 20:62246661-62246683 CCCAGGGCTTAGAAGGTGCTGGG + Intronic
1175925611 20:62469908-62469930 CCCAGCGCGGGCAAGCTGCTGGG - Intronic
1176044277 20:63084286-63084308 CCCCGGGCGAGGAGGGCACTGGG - Intergenic
1176099056 20:63356731-63356753 CCAAGGGCCGGGAGGGAGCAAGG - Intronic
1176125165 20:63471884-63471906 CCCAGGCTGAGGAGGGGGCTGGG + Intronic
1176260459 20:64176804-64176826 CCCAGGGCAGGCAGTGTGCTGGG - Intronic
1178104133 21:29299278-29299300 CCGAGGGCAGGGAGGGGGGTGGG - Intronic
1179150215 21:38803537-38803559 CCCAGGGCAAGGGGGCTGCTTGG + Intergenic
1179469428 21:41600820-41600842 GCCAGGGCGGGGAGATTGCTTGG + Intergenic
1179647737 21:42785476-42785498 CCCAGGGCGGCCAGGTGGCTGGG + Intergenic
1179721858 21:43320844-43320866 CCCAGGGTGGGTAGTGGGCTGGG - Intergenic
1180032930 21:45224531-45224553 CCCTGGGCGGGGCGGCTGTTGGG + Exonic
1180102340 21:45594796-45594818 CCCAGGGTGGGGTGGGAGCTTGG - Intergenic
1180781593 22:18523207-18523229 CCCAGGGCTGGCTGGGGGCTGGG + Intergenic
1180899414 22:19359676-19359698 CCCAAGGCAGGGAGAATGCTGGG + Intronic
1180958059 22:19750017-19750039 CCCAGGATGGGGTGGCTGCTGGG + Intergenic
1180977973 22:19860933-19860955 GCCAGGGCAGGGAGGTGGCTGGG + Intergenic
1181028858 22:20140549-20140571 GCCAGGGTGGGCAGGGGGCTGGG - Intronic
1181133485 22:20748466-20748488 CCCAGTGGGAGAAGGGTGCTGGG + Intronic
1181238477 22:21462550-21462572 CCCAGGGCTGGCTGGGGGCTGGG + Intergenic
1181256853 22:21568171-21568193 CCCAGGGCGGGGCGGTTCCGCGG - Intronic
1181335379 22:22124760-22124782 CCCAGGGCGGGGCGGGTGGGGGG + Intergenic
1181456646 22:23063765-23063787 CCCAGGGGTAGGAGGGAGCTGGG - Intronic
1181519582 22:23437381-23437403 CCTGGGGCGGGGAGGAGGCTGGG - Intergenic
1181801500 22:25350682-25350704 CCCAAGACTGGGAGGGTGCCTGG + Intergenic
1182427471 22:30282582-30282604 CCCAGGTGGGTGAGGCTGCTGGG - Intergenic
1182475564 22:30574706-30574728 CCCGGGGCGGGGAGGGGTCTGGG - Intergenic
1183455779 22:37922341-37922363 GCCGGGGCGTGGGGGGTGCTGGG - Exonic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1183736810 22:39648978-39649000 CCCAGGGAGGGGAGGAGGCATGG - Intronic
1183786178 22:40030395-40030417 CCCAAGGCAGGGAGGGAGCTTGG + Exonic
1184034814 22:41913356-41913378 CCCAGGGCATGGGGGTTGCTGGG + Intronic
1184450965 22:44582502-44582524 CCCAGGGCTGGTGAGGTGCTCGG + Intergenic
1184643415 22:45883941-45883963 CCCAGGGAGGGGTGGGTCCGAGG - Intergenic
1184760530 22:46541352-46541374 CTCAGGGCGGGGAGGGGGCTTGG + Intergenic
1184783925 22:46662734-46662756 CCCAGGGCGGGCAGAGAGCTGGG + Intronic
1184879319 22:47295030-47295052 CCAAGGCCTGGGACGGTGCTTGG + Intergenic
1185276718 22:49953088-49953110 CCCAGTGGGAGGAGGGGGCTGGG + Intergenic
1185380292 22:50504770-50504792 CCCAGGGCGGGCAGGGTGGTGGG - Intronic
949879105 3:8647975-8647997 CCCAGAGAGAGGAGGGTGCTTGG - Intronic
949980815 3:9500773-9500795 CCCAGGGCAGGGAGGCTCCCCGG + Exonic
950574231 3:13821770-13821792 CCCAGGGCGGGGAGGGGCTGTGG + Intronic
950707820 3:14793874-14793896 CCCAGGGTGGCGAGGGGCCTGGG - Intergenic
952382521 3:32816552-32816574 CCGAGTGCTGGGAGGGGGCTGGG - Intergenic
952867321 3:37862378-37862400 CACAGGGCCCGGAGGGTGCGTGG + Intronic
953310825 3:41877400-41877422 CCCAGGAGGCGGAGGCTGCTGGG - Intronic
953545295 3:43859912-43859934 CCCAGGGCAGGGAGGGAGAAGGG + Intergenic
953551832 3:43909011-43909033 CTCAGGGCTGGGAGGGTGTAGGG + Intergenic
953580692 3:44152948-44152970 CCAATGGCGGGGAGGTTGGTGGG + Intergenic
953598352 3:44338538-44338560 GCCGGAGCGGGGAGGGTGTTGGG + Exonic
953870296 3:46620226-46620248 CCCAGGGCAGGAAGGGTGTGGGG - Intronic
953909140 3:46883084-46883106 CCCAGTGGGGGGAGGGGGCGGGG - Intronic
954106143 3:48410760-48410782 CTCAGGGTGGGGAGGATGCTGGG - Intronic
954200770 3:49021922-49021944 CCCGGGGCGGGGAGGGCGGCAGG + Exonic
954225065 3:49176030-49176052 CCCAGGGCAAGGATGGAGCTAGG - Exonic
954304906 3:49720489-49720511 CCTAGGTAGGGGAGGGTGCAAGG - Exonic
954590526 3:51778175-51778197 CTCAGGGCCGGCAGAGTGCTTGG - Intergenic
954594522 3:51813716-51813738 CTCAGGGCCGGCAGAGTGCTTGG + Intergenic
954760659 3:52871304-52871326 CCCTGGGCAGAGAGGATGCTGGG + Intronic
955053182 3:55431950-55431972 TCCTGGGGGAGGAGGGTGCTAGG + Intergenic
955259923 3:57377854-57377876 CCAAGGGCTTGGAGGATGCTTGG - Intronic
955902634 3:63773739-63773761 CTAAGTGTGGGGAGGGTGCTTGG + Intergenic
956729964 3:72187466-72187488 CCCAGGGCTGGCATGGTGCAGGG - Intergenic
958641497 3:96813398-96813420 CCCAGGGCAGGGACGGAGCCCGG - Intergenic
960970295 3:123134718-123134740 CCCAGGGCAGCCACGGTGCTAGG + Intronic
961474991 3:127140771-127140793 CCAAGGGGAGGGCGGGTGCTGGG + Intergenic
961787776 3:129357917-129357939 CCCAGGGCAGGGAGGGGACAGGG + Intergenic
961818407 3:129563064-129563086 GGCAGGGCGGGGAGGGTCCCAGG - Intronic
961843490 3:129738892-129738914 CCCAGGTGGCGGAGGTTGCTGGG - Intronic
962827080 3:139107968-139107990 CCGAGGGCAGGCAGGGGGCTGGG + Intronic
962986928 3:140544701-140544723 CTCAGGGTGGGGAGGGGGCAGGG + Intronic
964814356 3:160700998-160701020 CTCAGTGTGGAGAGGGTGCTGGG + Intergenic
966165826 3:177015307-177015329 CCCTGGTCGTGGAGGATGCTAGG - Intergenic
966313875 3:178624728-178624750 CTCAGGGAGGGGTGGGGGCTCGG + Intronic
966850358 3:184161097-184161119 CCCAGAGCTGGGAATGTGCTTGG - Intronic
968501424 4:951938-951960 CTCAGGGCCGGGTGGGAGCTGGG - Intronic
968621370 4:1604820-1604842 CGCAGGGTGGGGGTGGTGCTCGG - Intergenic
968903739 4:3442550-3442572 CCGAGGGCGGGGAAGGTGTCAGG + Intronic
968913268 4:3486288-3486310 CCCAGGTCGGGGCGGGTGCTGGG + Intronic
969054076 4:4390774-4390796 TCCAGGGCTGGGAGGCTTCTTGG + Intronic
969426257 4:7125994-7126016 GCCGGGGCGGGGAGGGGGATGGG - Intergenic
969439337 4:7208148-7208170 GCCAGGCCAGGGAGGGAGCTGGG - Intronic
969496803 4:7530899-7530921 TCCAGGGCGGGCATAGTGCTTGG + Intronic
969680635 4:8641429-8641451 CTCAGGGCGGGCAGGATCCTGGG + Intergenic
970408613 4:15786816-15786838 CCCACGGCAGGGAGGGTGGGGGG + Intronic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
971792319 4:31185056-31185078 CCCACGGCGGGGCGGAGGCTGGG + Intergenic
972497980 4:39651706-39651728 CCCAAGGCAGGGAGCCTGCTGGG + Intergenic
973146353 4:46831321-46831343 CCCATGGCGGGGTGGGAGGTTGG - Intronic
977507720 4:97923296-97923318 CCCATGGCGGGGGGGGTGGGAGG - Intronic
978013736 4:103719462-103719484 CCCAGGGCTGGGAGGGCGCGGGG + Exonic
979482537 4:121236550-121236572 GCCTGGGCGGAGAGCGTGCTAGG - Intergenic
980007414 4:127558689-127558711 GCCACTGTGGGGAGGGTGCTGGG + Intergenic
980122845 4:128745344-128745366 CCCAGGGTGGACATGGTGCTCGG + Intergenic
982157495 4:152536203-152536225 CCCAGGGCGGGGTGGCTGGAAGG - Intergenic
982943061 4:161583123-161583145 CCCAGGGGGCGGAGGTTGCAGGG + Intronic
985523720 5:391377-391399 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523792 5:391622-391644 CACAGGGCGAGGAGGGCGCAGGG + Intronic
985523849 5:391818-391840 CACAGGGCGAGGAGGGCGCAGGG + Intronic
985523862 5:391867-391889 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523886 5:391973-391995 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523899 5:392022-392044 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523923 5:392128-392150 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523936 5:392177-392199 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523961 5:392275-392297 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523974 5:392324-392346 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523987 5:392373-392395 CGCAGGGCGAGGAGGGCGCAGGG + Intronic
985708374 5:1414452-1414474 GGCAGGGCGGGGAAGGCGCTGGG + Intronic
985708391 5:1414490-1414512 GTCAGGGCGGGGAAGGCGCTGGG + Intronic
987072861 5:14354160-14354182 AGCAGGGCTGGGAGGGTGGTTGG + Intronic
987127382 5:14827077-14827099 CCCAGGTCGGTGAGGTTCCTTGG - Intronic
987353547 5:17042550-17042572 CCCAGGAGGTGGAGAGTGCTGGG - Intergenic
989554502 5:42777384-42777406 CCCAGGAGGGGGAGGTTGCAGGG + Intronic
989559710 5:42836640-42836662 CACAGGGCTGGGGGGGTGCTTGG - Intronic
992444104 5:76819192-76819214 CCCAGCGCGGCGTGGCTGCTGGG + Exonic
994123438 5:96143551-96143573 CCCAGGGCGGGTAGAGTGCCTGG + Intergenic
994297277 5:98105744-98105766 TGCAGGGAGGGGAGGGTGCAAGG + Intergenic
996089428 5:119336326-119336348 CCCAGGGCAGGCAGGGTGGCCGG - Intronic
996387373 5:122923677-122923699 CCCAGGAAGGGAAGGTTGCTTGG - Intronic
997096909 5:130923786-130923808 CCCAGGGAGGTTAGGGTGTTAGG - Intergenic
997205615 5:132047323-132047345 GTCAGGGTGGGGAGGATGCTGGG + Intergenic
997643669 5:135466307-135466329 TCCAGGGCGTGGAGGGGGCCGGG - Intergenic
998173057 5:139883552-139883574 GCCCGGGCAGGGAGAGTGCTAGG + Intronic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000754724 5:165144085-165144107 CCCAGGGTGGAGAGGGTGAGGGG - Intergenic
1001106496 5:168858876-168858898 CCCTGGGCGGGCTGGGTGCAGGG + Intronic
1002446388 5:179292772-179292794 TCCAGGGTGGGGTGGGAGCTTGG - Intronic
1002521525 5:179795441-179795463 CCTCGGGCGGGGAGGGGGCGGGG + Intronic
1002533784 5:179864947-179864969 GGCAGGGCTGGGAGGGTGCAGGG + Intronic
1002576960 5:180179344-180179366 CCCAGGGACAGGAGGGGGCTTGG + Intronic
1002961097 6:1915448-1915470 CCCAGGGCCGGCACGGTGCAGGG + Intronic
1003026233 6:2558163-2558185 CCGAGGACAGGGCGGGTGCTGGG - Intergenic
1003292265 6:4789483-4789505 CCTAGGGCGGGGAGGCTGCCAGG - Intronic
1003324872 6:5084394-5084416 CGGTGGGCGGGGAGGGTGCTTGG + Intergenic
1003520893 6:6857377-6857399 CCAAGGGCGTGGAGGGTATTTGG - Intergenic
1004221821 6:13753874-13753896 CCCAGGGGGCGGAGGTTGCAGGG - Intergenic
1004275631 6:14233047-14233069 GCCATGGCAGGGAGGGAGCTGGG - Intergenic
1005812642 6:29529049-29529071 CCATGGGCAGGGAGGGTGGTTGG - Intergenic
1006163277 6:32050114-32050136 CCCAAGGCGGTGCGGGTGCCGGG - Intronic
1006164529 6:32056702-32056724 CCCAAGGCGGTGCGGGTGCCGGG - Intronic
1006165934 6:32064937-32064959 CCCAAGGCGGTGCGGGTGCCGGG - Intronic
1006166485 6:32068506-32068528 CCCAAGGCAGTGAGGGTGCCAGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006395065 6:33781872-33781894 CCGAGAGCAGGGAGGGTGCAGGG + Intronic
1006463521 6:34177532-34177554 CCCAGGGAGGGCTGGCTGCTGGG - Intergenic
1006471991 6:34234934-34234956 CCAAGGCCGCGGAGGCTGCTAGG - Intergenic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1007094503 6:39205043-39205065 CCCAGGGCAGGGGGGCAGCTGGG + Intronic
1007400351 6:41599433-41599455 GCCAGGGCAGGGTGGGAGCTGGG - Exonic
1007622478 6:43223458-43223480 CCCAGGGCAGGGGCTGTGCTGGG - Intronic
1007656852 6:43455667-43455689 CCCGGGGCGCGCCGGGTGCTAGG - Intronic
1007783198 6:44265631-44265653 CCGGGGGCGGGGAGGGGGCGGGG - Exonic
1007901283 6:45415517-45415539 GCCCAGGAGGGGAGGGTGCTGGG + Intronic
1008920731 6:56842873-56842895 CCCAGCGCAGGGAGGATGGTGGG - Intronic
1012414645 6:98999918-98999940 CACAGTGCAGGGAGGGTTCTAGG + Intergenic
1015415963 6:132948924-132948946 CCTTGGGAGGGGAGGGTCCTGGG + Intergenic
1016468281 6:144348239-144348261 CCCAGAGCTGGGCGTGTGCTAGG - Intronic
1016990703 6:149925943-149925965 CCCAGGGCGAGGAGGATGGGGGG - Intergenic
1018134662 6:160767526-160767548 CCCAGGGAGGCGAGGGCGCCCGG + Intergenic
1019058743 6:169241074-169241096 CCCAGGGCAGGGAGGGCGGCAGG - Intronic
1019176338 6:170161122-170161144 CCCCCGGCGGGGAGGGAGCGAGG - Intergenic
1019178697 6:170174434-170174456 GCCCTAGCGGGGAGGGTGCTTGG - Intergenic
1019183739 6:170208966-170208988 CCCTGGGCCTGGTGGGTGCTGGG - Intergenic
1019285240 7:220013-220035 CCCAGGGTGAGGAGCGGGCTTGG - Intronic
1019417915 7:935665-935687 CAGAGGGCGGGGGGGGAGCTGGG - Intronic
1019472302 7:1227482-1227504 CCCAGGGCGGGGAGGCAGGCAGG - Intergenic
1019522176 7:1466010-1466032 CCCTGGGAGGGGAGGGAGCCAGG - Intergenic
1019536086 7:1530629-1530651 CGCGGGGCGGGGAGGGGGCGTGG + Intergenic
1019591679 7:1838897-1838919 CCTGGGGCGGGGAGGAGGCTGGG + Intronic
1019597096 7:1863227-1863249 CCCAGGGCGGGGTGAATGCCGGG + Intronic
1019619053 7:1980628-1980650 CCCAGGGCGGGGGTGCTGCCAGG - Intronic
1019686530 7:2384913-2384935 CACAGAGCAGGGAGGGGGCTGGG + Intergenic
1019711349 7:2519554-2519576 CCCGGGGCGGGGGGGGTGCGGGG + Intronic
1019937339 7:4265061-4265083 CGCAGGGCCCGGAGCGTGCTGGG - Intronic
1020080507 7:5283580-5283602 CCCGGGCCGGGGAGGGCGGTGGG + Intronic
1020087923 7:5321414-5321436 GCCAGGCAGGGGAGGGGGCTAGG - Intronic
1020110220 7:5443600-5443622 CCCAGGGATGAGAGGGTGCCTGG - Intronic
1020140193 7:5607603-5607625 CCGACGGCGGGGAGGATGCGGGG - Intergenic
1021888010 7:25158810-25158832 CCCAGGAGGTGGAGGTTGCTGGG + Intronic
1022046789 7:26628050-26628072 CCCAGGCCGGGGAGGGAGGGAGG + Intergenic
1022425397 7:30264111-30264133 GCCAGGGCGGGAGGAGTGCTTGG - Intergenic
1022533655 7:31082577-31082599 CCCAGGGAGGGGAAGGAACTTGG + Intronic
1022660489 7:32362095-32362117 CCCAGGGCGGGGAGAACGATGGG + Intergenic
1023904677 7:44513731-44513753 CCCAGGGCAGGAAGGGTCCCAGG + Intronic
1025004766 7:55345098-55345120 GCCAGGGCGGGGCGCGGGCTGGG - Intergenic
1025198410 7:56948599-56948621 CCCGGGCCGGGGAGGGCGGTGGG - Intergenic
1025206376 7:56995688-56995710 GCCAGGCCGGGGAGGGGGCTGGG + Intergenic
1025673541 7:63628334-63628356 CCCGGGCCGGGGAGGGCGGTGGG + Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1028154930 7:87418884-87418906 CCCAAGGCTGGGAGGCTGGTAGG + Intronic
1028477981 7:91272461-91272483 CCCAGGGCTGGGAGTTTTCTTGG + Intergenic
1028916114 7:96261051-96261073 GCCTGAGAGGGGAGGGTGCTTGG - Intronic
1029161047 7:98552121-98552143 TCCAGGGAGGGGAGGGGGATTGG + Intergenic
1029506633 7:100967022-100967044 ACCAGGGCAGGGAGGGGGCTGGG + Intronic
1029545305 7:101207409-101207431 CCCAGGGGAGGGAGGGCGCCAGG - Intronic
1029694637 7:102204672-102204694 CCCACGGTGGGGAGTGTGGTTGG - Intronic
1030188726 7:106789803-106789825 CCCAGGGCGGGGAGGAGGAGGGG + Intergenic
1030866042 7:114702856-114702878 ACCAGGGCGGAGAGGTTGTTGGG + Intergenic
1031047764 7:116912493-116912515 CCTAGGGCTGGGAGGGTTCTGGG - Intronic
1032079952 7:128853854-128853876 CCCTGGGTGGGGCGGGTGGTGGG + Intronic
1032179675 7:129664047-129664069 CCCAGGGCAGGGAGGTTGCAGGG + Intronic
1033227927 7:139575483-139575505 CCCTCGGCTGGGAGGGTGGTCGG + Intronic
1034089997 7:148354851-148354873 CCCAGGGTGGGGTGTGTGCTAGG - Intronic
1034344847 7:150379628-150379650 CCGAGGGTGGGGAGGGCGCCAGG + Intronic
1034413986 7:150955517-150955539 CCCAGGGCAGGCAGGCTGCAGGG - Intronic
1034497619 7:151431921-151431943 GCCAGGGAGGGGAGAGTGGTGGG - Intronic
1034944711 7:155254368-155254390 GCCAGGGCGGGCAGGGCGTTTGG - Intergenic
1035060131 7:156062930-156062952 CCCAGGTCCGGGACGGTCCTCGG + Intergenic
1035325682 7:158064477-158064499 CCCAGCGCTGTGAGGTTGCTTGG + Intronic
1035782512 8:2239655-2239677 CCCAGAGAGGGGAGGGTGGCAGG - Intergenic
1035809608 8:2479933-2479955 CCCAGAGAGGGGAGGGTGGCAGG + Intergenic
1036001305 8:4608060-4608082 CCCTGGGAGGAGATGGTGCTTGG + Intronic
1036482434 8:9150828-9150850 CCCGGGACGGGGATCGTGCTAGG + Intronic
1036709943 8:11071803-11071825 CCCAGTGGGGAGAGGGTGCTGGG - Intronic
1037572448 8:20170014-20170036 GCCAGGGCTGGAGGGGTGCTGGG + Intronic
1037826795 8:22164841-22164863 CCCGCGGCGGGGCGGGGGCTCGG + Exonic
1039413852 8:37377203-37377225 CCCAGGCAGGCCAGGGTGCTCGG + Intergenic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040537250 8:48321076-48321098 CTCAAGGCGGAAAGGGTGCTGGG + Intergenic
1044666910 8:94641107-94641129 CCCAGGGCAGGAAGGGGGGTGGG - Exonic
1044819391 8:96145399-96145421 CCCAGGGCGCTGAGGGCGCCTGG + Exonic
1047248734 8:123166101-123166123 ATCAGGGCCGGGAGGGGGCTGGG + Intergenic
1048280649 8:133103095-133103117 CTCAGGGACGGGAGGGTGTTAGG + Intronic
1048335279 8:133497931-133497953 CCTGGGGCAGGGAGTGTGCTTGG - Intronic
1048812970 8:138304952-138304974 CCCAGGGCCGGCAGGGTGGCCGG - Intronic
1049177998 8:141206006-141206028 CCCAGGGCGCGGAGGGCGGCGGG - Intergenic
1049268508 8:141682074-141682096 CCCTGGGCGGGGCTGGGGCTAGG - Intergenic
1049408361 8:142461617-142461639 CCCAGGGCGGGGCAGGTTCTAGG - Intronic
1049446854 8:142635187-142635209 CCCAGGGCTGGGCGGGAGCTGGG - Intergenic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1049578861 8:143401752-143401774 CCCAGGGCTGGGAGGAGGGTTGG + Intergenic
1049593916 8:143474833-143474855 CCCTGGGCTGGGAGGGCGCAAGG + Intronic
1049662092 8:143824107-143824129 GCCTGGGTGGGGAGGGTGCAGGG + Intronic
1049747965 8:144270993-144271015 CGCTGGGCGGGGCGGGTGGTGGG - Intronic
1049795952 8:144497325-144497347 CCCAGGGCAAGAAGGGTCCTGGG + Exonic
1049807717 8:144548400-144548422 CCCTGGGCGGCGAGGAAGCTGGG + Exonic
1049975449 9:857229-857251 CCCAGGACGTGGAGGTTGCAGGG + Intronic
1051262733 9:15280643-15280665 CCAAGGGCCAGGAGGCTGCTTGG - Intronic
1052820654 9:33135681-33135703 GTCAGAGCGGGGAGGGTCCTGGG - Intronic
1052840861 9:33289874-33289896 CCCAGGGAGGGGTGGGGGCTCGG - Intergenic
1053537299 9:38938253-38938275 CCGAGGGCAGGGTGCGTGCTGGG + Intergenic
1054628836 9:67425677-67425699 CCGAGGGCAGGGTGCGTGCTGGG - Intergenic
1055905934 9:81293055-81293077 AGCGGGGCGGGGAGGGTGGTTGG + Intergenic
1056558212 9:87707134-87707156 AGCAGGGCGTGGAGGGGGCTGGG - Exonic
1056581271 9:87889340-87889362 CACGGGGCAGGGAGGCTGCTGGG - Intergenic
1056965329 9:91160094-91160116 AGAGGGGCGGGGAGGGTGCTTGG - Intergenic
1056992831 9:91426462-91426484 ACCAGGGTGGGGAGGCTTCTAGG + Intergenic
1057147086 9:92765314-92765336 CCCAGGGGGAGGCGGGTGCGGGG + Intergenic
1057606227 9:96499436-96499458 CACAAGCTGGGGAGGGTGCTGGG + Intronic
1057652932 9:96933317-96933339 CCCAGGTCAGAGAGGGTTCTTGG + Intronic
1057758062 9:97853053-97853075 GTCAGGGCGGGGAGGGCGCTTGG - Intergenic
1058911848 9:109527383-109527405 CCAGGGGCGGGGAGGTTGCAGGG + Intergenic
1060151758 9:121293282-121293304 CCCAGGGCCTGAAGGGTTCTTGG + Intronic
1060404152 9:123364827-123364849 CCCAGGACTGCGAGGGTTCTGGG + Intronic
1060479888 9:124011869-124011891 CCCAGGGAGGGGAGGGGTCCAGG + Exonic
1060933560 9:127503536-127503558 CCCAGGGAGGGGAGGGGACGAGG + Intergenic
1060962670 9:127692140-127692162 TCAAGGGCGGCGAGGGGGCTGGG - Exonic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061401438 9:130370507-130370529 CCCAGGGGGGTGGGGGTGTTGGG - Intronic
1061615491 9:131776181-131776203 TTCAGGGAGGGGAGGGAGCTGGG - Intergenic
1061670403 9:132185221-132185243 CCCAGGGTGGGGAAGGGGGTCGG - Intronic
1061789671 9:133052362-133052384 GCCAGGACGGGGGAGGTGCTAGG - Intronic
1061796363 9:133087875-133087897 CAGAGGATGGGGAGGGTGCTGGG + Intergenic
1061859458 9:133460456-133460478 CCCAGGGCGGGGGGGCGGCGGGG + Intronic
1062096584 9:134706925-134706947 CACAGGCTGGGGAAGGTGCTGGG - Intronic
1062229610 9:135474418-135474440 CCCAGGGCGGGGGAGCTGCATGG - Intergenic
1062276706 9:135734820-135734842 CCTGGGGCGGGGAGGAAGCTGGG - Intronic
1062332796 9:136051846-136051868 CCTGGGGCGGGGAGGGCGCAGGG + Intronic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062538307 9:137030462-137030484 TTCAGGGTGGGGAGGGTCCTCGG + Exonic
1062729698 9:138102058-138102080 CCCAGGGCAGGGCTGCTGCTGGG - Intronic
1185586104 X:1243098-1243120 TCCTGGGCGGGGAGGGTGGGGGG - Intergenic
1185673117 X:1827077-1827099 CCCAGTGTTGGGGGGGTGCTGGG - Intergenic
1185877768 X:3713780-3713802 CCCCGGGCGCGGAGGGGGCGTGG - Intergenic
1186012350 X:5148622-5148644 CCCAGGACAGGGAGGTTGCAGGG + Intergenic
1186670630 X:11764231-11764253 CACAGGCCGGGGAGGGTGGAAGG + Intronic
1190055961 X:47181219-47181241 CCCAAGGTGGGGAGGGTACCTGG + Exonic
1190881559 X:54495692-54495714 CCCCGCGCGGGGAGTGGGCTCGG + Exonic
1195043426 X:101034483-101034505 CCCATGGCAGGGAGGGAACTGGG + Intronic
1196830116 X:119769218-119769240 CCCAGGAGGTGGAGGTTGCTGGG - Intergenic
1197735472 X:129847684-129847706 CCCAGGTGGGGTAGGGGGCTGGG - Intergenic
1199950338 X:152701115-152701137 TCCAGGTCAGGGAAGGTGCTTGG - Exonic
1199959340 X:152767346-152767368 TCCAGGTCAGGGAAGGTGCTTGG + Exonic
1200056715 X:153465433-153465455 GCGAGGCCGGGGAGGGTGCCAGG - Intronic
1200158387 X:153990668-153990690 GCCAGGGTGGGGAGAGTGGTGGG + Intergenic
1200256970 X:154587766-154587788 CCCAGGAGGTGGAGGGTGCAGGG + Intergenic
1200260799 X:154616636-154616658 CCCAGGAGGTGGAGGGTGCAGGG - Intergenic
1200787555 Y:7273759-7273781 CCCCGGGCGCGGAGGGGGCGTGG + Intergenic
1201321209 Y:12700165-12700187 TTCAGGGCAGGGAAGGTGCTTGG + Intergenic
1202605389 Y:26635446-26635468 CCTAGGGTGGGTAGGGTGCCAGG + Intergenic