ID: 1062364814

View in Genome Browser
Species Human (GRCh38)
Location 9:136203503-136203525
Sequence GTCCTCCCGCCGCTGAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062364803_1062364814 23 Left 1062364803 9:136203457-136203479 CCAGGAGGGCTAAGGTTCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1062364814 9:136203503-136203525 GTCCTCCCGCCGCTGAGGTTTGG No data
1062364810_1062364814 5 Left 1062364810 9:136203475-136203497 CCGGGAGAGGGGTCGAGAAGGCA 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1062364814 9:136203503-136203525 GTCCTCCCGCCGCTGAGGTTTGG No data
1062364809_1062364814 6 Left 1062364809 9:136203474-136203496 CCCGGGAGAGGGGTCGAGAAGGC 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1062364814 9:136203503-136203525 GTCCTCCCGCCGCTGAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062364814 Original CRISPR GTCCTCCCGCCGCTGAGGTT TGG Intronic
No off target data available for this crispr