ID: 1062368524

View in Genome Browser
Species Human (GRCh38)
Location 9:136224112-136224134
Sequence GACCCTGGTGTGCTTCCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062368524_1062368533 23 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368533 9:136224158-136224180 CGTGGGGCAGGCATACACCCAGG 0: 1
1: 0
2: 1
3: 4
4: 104
1062368524_1062368531 11 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368531 9:136224146-136224168 TGCGGCTGTCCTCGTGGGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 130
1062368524_1062368529 6 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368529 9:136224141-136224163 GTGTGTGCGGCTGTCCTCGTGGG 0: 1
1: 0
2: 1
3: 8
4: 102
1062368524_1062368530 7 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368530 9:136224142-136224164 TGTGTGCGGCTGTCCTCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
1062368524_1062368528 5 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368528 9:136224140-136224162 TGTGTGTGCGGCTGTCCTCGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1062368524_1062368527 -7 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368527 9:136224128-136224150 CAGGGTCAGAGCTGTGTGTGCGG 0: 1
1: 0
2: 4
3: 48
4: 448
1062368524_1062368534 24 Left 1062368524 9:136224112-136224134 CCTGCCGGAAGCACACCAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1062368534 9:136224159-136224181 GTGGGGCAGGCATACACCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062368524 Original CRISPR GACCCTGGTGTGCTTCCGGC AGG (reversed) Exonic
900914307 1:5624045-5624067 GATACTTGTTTGCTTCCGGCTGG - Intergenic
901063522 1:6484737-6484759 GACCCTGGTGTCCCTCCTGCAGG - Intronic
902149398 1:14430711-14430733 CACCCTGGTGTGAGTCCTGCAGG - Intergenic
903542719 1:24105967-24105989 GACCGTGGTGTGCTCCCAGACGG + Exonic
904945452 1:34195849-34195871 GACCATGGAATGCTTCCAGCAGG - Intronic
905012366 1:34756064-34756086 GAGCCTGGTGAGCTTCAGCCTGG + Intronic
909546543 1:76854493-76854515 GGCCCTGGGGTGATTCCGGCAGG - Intergenic
911363299 1:96906219-96906241 GACCCTGATCTGCTTCAGGGAGG - Intergenic
913107072 1:115624617-115624639 GACCCTGGAGTGATTTGGGCAGG + Intergenic
915316469 1:155031557-155031579 GACCCTGGTTTTCTCACGGCTGG + Exonic
921934689 1:220786212-220786234 GTCCCCGGGCTGCTTCCGGCGGG - Intergenic
1066497760 10:35958888-35958910 GTCCCTGCTGGGCTTCAGGCTGG + Intergenic
1066625408 10:37400972-37400994 GTCCCTGCTGGGCTTCAGGCTGG + Intergenic
1067088547 10:43255163-43255185 GATCCTGCTGTCCTTCCTGCTGG - Intronic
1067105211 10:43362015-43362037 GACCCTGGGGAGTTTCCTGCTGG - Intergenic
1067451404 10:46384264-46384286 GATCCTGGTGTGCCTCCTGCAGG + Intronic
1067585838 10:47475492-47475514 GATCCTGGTGTGCCTCCTGCAGG - Exonic
1067901608 10:50247510-50247532 GACCCTGCTGTGCCTACTGCTGG + Intronic
1071179620 10:82967825-82967847 GAACCTGGTGTGGTTCCTGGAGG + Intronic
1072615680 10:97047722-97047744 GATCTTGGTGAGCTTCAGGCTGG + Exonic
1073285478 10:102385023-102385045 GGCCCTGTTGTACTTCCAGCTGG + Intergenic
1075604939 10:123797946-123797968 CACCCTCCTGTGCTTCCTGCAGG - Intronic
1076686566 10:132200823-132200845 GACCCTGGCTTGTTTCCAGCGGG + Exonic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077194451 11:1272302-1272324 CACCCTGGGGTGCTGCAGGCCGG - Intergenic
1080668813 11:34358017-34358039 TACCCAGCTGTGCTGCCGGCCGG - Intergenic
1084083509 11:66843973-66843995 CACCCTGATGGGCTTCAGGCTGG + Exonic
1098417222 12:70248033-70248055 TACCCTGTTTTGCTTCTGGCAGG + Intronic
1102951909 12:117036786-117036808 GAGCCTGGTGTGGTCCCAGCGGG - Intergenic
1103420169 12:120774336-120774358 GAACCTGGTGACCTTCAGGCAGG - Intronic
1104747930 12:131221611-131221633 CACCCTGGAGGGCTTCCTGCAGG - Intergenic
1105018182 12:132798846-132798868 GGCCCTGGTGTGTGTCTGGCTGG - Intronic
1111484348 13:88876689-88876711 GACCATGGAGTGGTTCTGGCAGG - Intergenic
1112342766 13:98566129-98566151 TAGCCTGGCGTGCTTCTGGCTGG - Intronic
1113200962 13:107867240-107867262 GAGCCTGGGCTGCCTCCGGCGGG + Intergenic
1113646772 13:112003112-112003134 GACACTGGTGTCCTTCTGGTGGG + Intergenic
1113806850 13:113115061-113115083 AGCCCTGGTGTGCATCCTGCAGG + Intronic
1119547193 14:75480455-75480477 GACCCTGCTCTGCTTCAGGTGGG + Intergenic
1122923058 14:104887853-104887875 GGCCATGGTGGGCTTGCGGCTGG - Exonic
1123714625 15:23017882-23017904 CACCATGGTGTGCTGCCTGCTGG + Exonic
1125391771 15:39200194-39200216 GAGGCTGGTGTGGTTCCTGCAGG - Intergenic
1128496611 15:68201826-68201848 GACCCAGCTGGGCTTCCTGCTGG + Intronic
1132155641 15:99493609-99493631 GTCCCTGGTGGGCTGACGGCAGG - Intergenic
1132981261 16:2739676-2739698 GTCCCTGGTGTGCTGCAGCCTGG - Intergenic
1135139228 16:19907566-19907588 GCCCGTGGTGAGCTTCCCGCAGG + Intergenic
1137720238 16:50623412-50623434 GACCCAGGTGGGCTTAGGGCGGG - Intronic
1139436796 16:66941165-66941187 GGCCCTGGTGGGCTGCCTGCGGG + Exonic
1141082662 16:81066216-81066238 AACACTGGTGTACTTCAGGCAGG + Exonic
1142435262 16:90052722-90052744 GACCAGGCAGTGCTTCCGGCCGG - Intergenic
1142435323 16:90053037-90053059 GACCAGGCAGTGCTTCCGGCCGG - Intergenic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1144705832 17:17367286-17367308 GACCCTCGTGGGCTGCCAGCTGG + Intergenic
1144856637 17:18272311-18272333 AACCCTGGTGTGCTGCTGGTGGG + Intronic
1145285191 17:21500359-21500381 GACCCTGGAGAGCTTCAGGATGG - Intergenic
1147442342 17:40454791-40454813 GGCTCTGGTGTGCCTCCTGCTGG + Intronic
1147754995 17:42761872-42761894 GACCCTGGTGTGCCTGTGGTGGG - Exonic
1148858397 17:50591507-50591529 GAAGCTGGTGCGCTTCCTGCCGG + Exonic
1151983906 17:77529726-77529748 GAACCAGGTGTCCTTCCCGCAGG + Intergenic
1160776609 19:859508-859530 GACTCTGGTGTGAGTCTGGCAGG + Intergenic
1160907016 19:1456284-1456306 GACCCTGGTGCTCTCCCTGCAGG + Exonic
1161118263 19:2511567-2511589 GACCCGGGGGGGCTTCCGGGTGG - Exonic
1164669089 19:30062921-30062943 GAGCCTGGAGTGCTCCTGGCAGG + Intergenic
1166852773 19:45768433-45768455 GGCCCTGGTGGCCTTCCAGCGGG - Exonic
1167012938 19:46820931-46820953 GACCCTGGTTAACTTCAGGCAGG + Intergenic
1167696216 19:51016980-51017002 GTCCCCGGTGTCCTTCCAGCAGG - Intronic
1168547246 19:57263571-57263593 GACCCTGGAGTGGTTATGGCAGG - Intergenic
925681955 2:6431773-6431795 TATCCTGGTGTCCTTCCGGCAGG - Intergenic
926019816 2:9485159-9485181 GACACTGGCGTGTTTCCAGCAGG - Intronic
927589057 2:24336970-24336992 GAGCCTGTTCTGCTTCCTGCTGG - Intronic
928759659 2:34567236-34567258 AACCCTGGCTTGCTTCCCGCTGG - Intergenic
932495543 2:72144213-72144235 GACCCGGGTGTGGCTCCCGCAGG - Exonic
932702165 2:73999629-73999651 GACCCTACTGTGCTCCCAGCAGG - Intronic
936077966 2:109413841-109413863 GACCCCAGTGTGCTCCCTGCAGG - Intronic
936865676 2:117074012-117074034 GACCCTGGAGTGATTAAGGCAGG - Intergenic
944114999 2:196176442-196176464 GAGCCTGGTGTGTTTGTGGCTGG - Intronic
946225172 2:218260717-218260739 GAGCCTGGTGTGCTGTCAGCTGG + Intronic
949003660 2:241633067-241633089 GAGCCAGGTGTGCTGCCTGCGGG - Exonic
1169562660 20:6818707-6818729 GACCCTGTTGCTCTTCCCGCTGG + Intergenic
1170740309 20:19050101-19050123 GACTCTGGTGTACTTCTGGTGGG + Intergenic
1171935896 20:31274580-31274602 GGCCCTGGTGTCCATCCGGAAGG + Intergenic
1172690127 20:36784343-36784365 GACCCTGGTGTTCAGCCTGCAGG + Exonic
1175896597 20:62338550-62338572 CACCCTTGGGTCCTTCCGGCAGG + Exonic
1175980474 20:62736164-62736186 GAGCCTGGGGTGCCTCGGGCAGG + Intronic
1180177842 21:46098744-46098766 GGCCCTGGTGGGCTCCAGGCCGG - Intronic
1181158581 22:20941924-20941946 GGCCCTGGTGTGGTTCAGGCAGG + Intronic
1181466270 22:23112306-23112328 GAGCCTGGTGTGCTTGGGGCGGG - Intronic
1183483209 22:38076009-38076031 GACCTTTCTGTGCTTCCGACAGG + Intergenic
951766286 3:26203356-26203378 GAATCTGGTGTGCTTCATGCAGG + Intergenic
954335063 3:49911559-49911581 GGCCCTGGTGTCCTTCCTGGAGG - Exonic
962975468 3:140442288-140442310 GACCCTGGGGTGATTAGGGCAGG - Intronic
966484649 3:180454159-180454181 GACCCTGGTGTTCTCCCAACTGG + Intergenic
970118308 4:12724080-12724102 GACCCTGTTGCCCTTCCTGCTGG - Intergenic
972954812 4:44376182-44376204 GACTCTGGTGTGCTTCCTGTGGG - Intronic
979662377 4:123272157-123272179 GACACTGTTGTGCTTCTGACTGG + Intronic
985912952 5:2897369-2897391 GACACAGGTGTGCTTCAGGGCGG - Intergenic
988528704 5:32008830-32008852 GACCCAGGTGGGCTTTCGGAAGG + Intronic
996388101 5:122930180-122930202 AGCCCTTGTGTGCTTCCTGCTGG + Intronic
999150159 5:149421437-149421459 CACCCTGGTGTCCTTCTGACAGG + Intergenic
999383667 5:151139487-151139509 GGCCCTGGTGGGCTTCCTGGAGG - Intronic
1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG + Intergenic
1007400600 6:41600270-41600292 GACCCTGGGCTGCTTCCTGGGGG + Exonic
1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG + Intronic
1017984951 6:159435706-159435728 GGCCCTGGGGTGATTACGGCAGG - Intergenic
1019225785 6:170506907-170506929 GACCGTGGACTGCTTCTGGCCGG - Intergenic
1020154452 7:5710826-5710848 GTCCCTTGTGTGCTTCCAGTGGG - Intronic
1022106543 7:27201084-27201106 GCCCCAGCTGTGCTTCTGGCTGG + Intergenic
1026930503 7:74220697-74220719 GACCCGTGTCTGCTTCCTGCGGG - Exonic
1029464548 7:100716976-100716998 GAGGCTGGTATGCTTCTGGCTGG - Intergenic
1031363224 7:120871804-120871826 GACCCTGGCTTGCTTCTTGCAGG - Intergenic
1032709310 7:134448371-134448393 GGCCCTGGTGAGCTTCCCACAGG - Exonic
1034100095 7:148443548-148443570 GACCCCTCTGTGCTTCTGGCTGG - Intergenic
1034904303 7:154930375-154930397 GAACATGGTGTTCTTCAGGCTGG - Intronic
1036655799 8:10676535-10676557 GACCCAGGTGTGCCTAAGGCTGG - Intronic
1037502185 8:19496910-19496932 GACCATGCTGTGCAGCCGGCGGG + Intronic
1037784850 8:21896467-21896489 GCCCCTGATGTGATTCAGGCAGG - Intergenic
1043568253 8:81571366-81571388 GACCCTGGGGTGGGTCCGCCTGG + Intergenic
1049377383 8:142295731-142295753 TGGCCTGGTGTGCTTCCAGCTGG + Intronic
1049433388 8:142575473-142575495 GACCCGGGGGTGCTTTGGGCTGG + Intergenic
1049731274 8:144179821-144179843 GACCGTGGTGTGCGTGCAGCTGG + Intronic
1057822396 9:98342606-98342628 GACCATGGTCTGCATCTGGCTGG + Intronic
1061204019 9:129152698-129152720 GACCCCGGTGTCCCTACGGCAGG - Intergenic
1061285803 9:129621826-129621848 CACCCTGGTGGGCTTCTGGGTGG + Intronic
1061883637 9:133580038-133580060 GACCCTTGTGACCTTCAGGCGGG + Intronic
1062293006 9:135805817-135805839 GGCCCTGCTGTGCTGCCTGCGGG + Intergenic
1062368524 9:136224112-136224134 GACCCTGGTGTGCTTCCGGCAGG - Exonic
1062510309 9:136901771-136901793 GACCCTGGGGTGTTACCGGCTGG + Intronic
1186300962 X:8199356-8199378 GTCCCTGTTGTTCTTCCAGCAGG - Intergenic
1187242062 X:17522519-17522541 GGCCCTGGGCTGCTTCCGGATGG - Intronic
1187353797 X:18546885-18546907 GATCCTGCAGTGCTTCCTGCAGG + Intronic
1189551319 X:42096455-42096477 GATCATGGAGTGGTTCCGGCCGG + Intergenic