ID: 1062370383

View in Genome Browser
Species Human (GRCh38)
Location 9:136235753-136235775
Sequence TGGTGGCTACAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062370369_1062370383 23 Left 1062370369 9:136235707-136235729 CCCCTCTCCCTCGCGCTGGGTCA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370372_1062370383 16 Left 1062370372 9:136235714-136235736 CCCTCGCGCTGGGTCACACCCAG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370373_1062370383 15 Left 1062370373 9:136235715-136235737 CCTCGCGCTGGGTCACACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 241
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370371_1062370383 21 Left 1062370371 9:136235709-136235731 CCTCTCCCTCGCGCTGGGTCACA 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370370_1062370383 22 Left 1062370370 9:136235708-136235730 CCCTCTCCCTCGCGCTGGGTCAC 0: 1
1: 0
2: 0
3: 7
4: 164
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370376_1062370383 -2 Left 1062370376 9:136235732-136235754 CCCAGGCGACCCGTGGAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370377_1062370383 -3 Left 1062370377 9:136235733-136235755 CCAGGCGACCCGTGGAGCTCTGG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data
1062370366_1062370383 29 Left 1062370366 9:136235701-136235723 CCTGCTCCCCTCTCCCTCGCGCT 0: 1
1: 0
2: 0
3: 110
4: 1001
Right 1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062370383 Original CRISPR TGGTGGCTACAGAGGCAGCA TGG Intronic
No off target data available for this crispr