ID: 1062372676

View in Genome Browser
Species Human (GRCh38)
Location 9:136248112-136248134
Sequence GGCAGATTTCACGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062372676_1062372678 -5 Left 1062372676 9:136248112-136248134 CCAAAGCCTGCGTGAAATCTGCC No data
Right 1062372678 9:136248130-136248152 CTGCCCCCCACCCCACCTGCAGG No data
1062372676_1062372682 0 Left 1062372676 9:136248112-136248134 CCAAAGCCTGCGTGAAATCTGCC No data
Right 1062372682 9:136248135-136248157 CCCCACCCCACCTGCAGGAGAGG No data
1062372676_1062372691 29 Left 1062372676 9:136248112-136248134 CCAAAGCCTGCGTGAAATCTGCC No data
Right 1062372691 9:136248164-136248186 ACGTCGCTGTGGCAAAGGCCAGG No data
1062372676_1062372690 24 Left 1062372676 9:136248112-136248134 CCAAAGCCTGCGTGAAATCTGCC No data
Right 1062372690 9:136248159-136248181 ATCGCACGTCGCTGTGGCAAAGG No data
1062372676_1062372689 18 Left 1062372676 9:136248112-136248134 CCAAAGCCTGCGTGAAATCTGCC No data
Right 1062372689 9:136248153-136248175 AGAGGCATCGCACGTCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062372676 Original CRISPR GGCAGATTTCACGCAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr