ID: 1062373364

View in Genome Browser
Species Human (GRCh38)
Location 9:136251648-136251670
Sequence GAGCAGCGCCTATGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062373364_1062373369 3 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373364_1062373374 29 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG No data
1062373364_1062373373 28 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062373364 Original CRISPR GAGCAGCGCCTATGCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr