ID: 1062373369

View in Genome Browser
Species Human (GRCh38)
Location 9:136251674-136251696
Sequence CCCGTCCTCGTTCCTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062373362_1062373369 5 Left 1062373362 9:136251646-136251668 CCCCTTCCTGGCATAGGCGCTGC No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373359_1062373369 12 Left 1062373359 9:136251639-136251661 CCATGACCCCCTTCCTGGCATAG No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373365_1062373369 -1 Left 1062373365 9:136251652-136251674 CCTGGCATAGGCGCTGCTCCGCC No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373357_1062373369 14 Left 1062373357 9:136251637-136251659 CCCCATGACCCCCTTCCTGGCAT No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373355_1062373369 25 Left 1062373355 9:136251626-136251648 CCTTCGCTGATCCCCATGACCCC No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373363_1062373369 4 Left 1062373363 9:136251647-136251669 CCCTTCCTGGCATAGGCGCTGCT No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373364_1062373369 3 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373358_1062373369 13 Left 1062373358 9:136251638-136251660 CCCATGACCCCCTTCCTGGCATA No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
1062373361_1062373369 6 Left 1062373361 9:136251645-136251667 CCCCCTTCCTGGCATAGGCGCTG No data
Right 1062373369 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062373369 Original CRISPR CCCGTCCTCGTTCCTGCTCT TGG Intergenic