ID: 1062373373

View in Genome Browser
Species Human (GRCh38)
Location 9:136251699-136251721
Sequence ACTCTGACTGTTCTTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062373368_1062373373 2 Left 1062373368 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373364_1062373373 28 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373365_1062373373 24 Left 1062373365 9:136251652-136251674 CCTGGCATAGGCGCTGCTCCGCC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373366_1062373373 6 Left 1062373366 9:136251670-136251692 CCGCCCCGTCCTCGTTCCTGCTC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373367_1062373373 3 Left 1062373367 9:136251673-136251695 CCCCGTCCTCGTTCCTGCTCTTG No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373371_1062373373 -3 Left 1062373371 9:136251679-136251701 CCTCGTTCCTGCTCTTGGCGACT No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373370_1062373373 1 Left 1062373370 9:136251675-136251697 CCGTCCTCGTTCCTGCTCTTGGC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373362_1062373373 30 Left 1062373362 9:136251646-136251668 CCCCTTCCTGGCATAGGCGCTGC No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373363_1062373373 29 Left 1062373363 9:136251647-136251669 CCCTTCCTGGCATAGGCGCTGCT No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data
1062373372_1062373373 -10 Left 1062373372 9:136251686-136251708 CCTGCTCTTGGCGACTCTGACTG No data
Right 1062373373 9:136251699-136251721 ACTCTGACTGTTCTTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062373373 Original CRISPR ACTCTGACTGTTCTTGCCTC TGG Intergenic