ID: 1062373374

View in Genome Browser
Species Human (GRCh38)
Location 9:136251700-136251722
Sequence CTCTGACTGTTCTTGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 286}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062373372_1062373374 -9 Left 1062373372 9:136251686-136251708 CCTGCTCTTGGCGACTCTGACTG No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373365_1062373374 25 Left 1062373365 9:136251652-136251674 CCTGGCATAGGCGCTGCTCCGCC No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373363_1062373374 30 Left 1062373363 9:136251647-136251669 CCCTTCCTGGCATAGGCGCTGCT No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373366_1062373374 7 Left 1062373366 9:136251670-136251692 CCGCCCCGTCCTCGTTCCTGCTC No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373367_1062373374 4 Left 1062373367 9:136251673-136251695 CCCCGTCCTCGTTCCTGCTCTTG No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373371_1062373374 -2 Left 1062373371 9:136251679-136251701 CCTCGTTCCTGCTCTTGGCGACT No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373364_1062373374 29 Left 1062373364 9:136251648-136251670 CCTTCCTGGCATAGGCGCTGCTC No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373368_1062373374 3 Left 1062373368 9:136251674-136251696 CCCGTCCTCGTTCCTGCTCTTGG No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286
1062373370_1062373374 2 Left 1062373370 9:136251675-136251697 CCGTCCTCGTTCCTGCTCTTGGC No data
Right 1062373374 9:136251700-136251722 CTCTGACTGTTCTTGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062373374 Original CRISPR CTCTGACTGTTCTTGCCTCT GGG Intergenic