ID: 1062375592

View in Genome Browser
Species Human (GRCh38)
Location 9:136260470-136260492
Sequence AGTCTCAAGGGGCCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062375592_1062375599 7 Left 1062375592 9:136260470-136260492 CCAGCATGTGGCCCCTTGAGACT No data
Right 1062375599 9:136260500-136260522 GGAGATGGACTGTCCCTCCCAGG No data
1062375592_1062375600 19 Left 1062375592 9:136260470-136260492 CCAGCATGTGGCCCCTTGAGACT No data
Right 1062375600 9:136260512-136260534 TCCCTCCCAGGTGCACATGCTGG No data
1062375592_1062375602 20 Left 1062375592 9:136260470-136260492 CCAGCATGTGGCCCCTTGAGACT No data
Right 1062375602 9:136260513-136260535 CCCTCCCAGGTGCACATGCTGGG No data
1062375592_1062375597 -8 Left 1062375592 9:136260470-136260492 CCAGCATGTGGCCCCTTGAGACT No data
Right 1062375597 9:136260485-136260507 TTGAGACTTCTGCCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062375592 Original CRISPR AGTCTCAAGGGGCCACATGC TGG (reversed) Intergenic
No off target data available for this crispr