ID: 1062376420

View in Genome Browser
Species Human (GRCh38)
Location 9:136263887-136263909
Sequence GCCCTGGCCCTCACACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062376411_1062376420 8 Left 1062376411 9:136263856-136263878 CCAACAAAAGGGAAGGGGTGTCT No data
Right 1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG No data
1062376405_1062376420 24 Left 1062376405 9:136263840-136263862 CCAGCAGGGGAAAAGGCCAACAA No data
Right 1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG No data
1062376404_1062376420 30 Left 1062376404 9:136263834-136263856 CCGGAGCCAGCAGGGGAAAAGGC No data
Right 1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062376420 Original CRISPR GCCCTGGCCCTCACACTGGG AGG Intergenic
No off target data available for this crispr