ID: 1062377897

View in Genome Browser
Species Human (GRCh38)
Location 9:136272178-136272200
Sequence CAGCAGAAGGAAAAGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062377890_1062377897 5 Left 1062377890 9:136272150-136272172 CCACCAGAAATGCTAAGGGAAAT No data
Right 1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG No data
1062377891_1062377897 2 Left 1062377891 9:136272153-136272175 CCAGAAATGCTAAGGGAAATCCT No data
Right 1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG No data
1062377887_1062377897 19 Left 1062377887 9:136272136-136272158 CCAGCAGACACGCACCACCAGAA No data
Right 1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062377897 Original CRISPR CAGCAGAAGGAAAAGGATGC GGG Intergenic
No off target data available for this crispr