ID: 1062379154

View in Genome Browser
Species Human (GRCh38)
Location 9:136278471-136278493
Sequence GAGGAGTCAGGGCACTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379154_1062379160 -8 Left 1062379154 9:136278471-136278493 CCCAGTGAGTGCCCTGACTCCTC No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379154 Original CRISPR GAGGAGTCAGGGCACTCACT GGG (reversed) Intergenic
No off target data available for this crispr