ID: 1062379160

View in Genome Browser
Species Human (GRCh38)
Location 9:136278486-136278508
Sequence GACTCCTCTAGCAATGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379155_1062379160 -9 Left 1062379155 9:136278472-136278494 CCAGTGAGTGCCCTGACTCCTCT No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data
1062379153_1062379160 -7 Left 1062379153 9:136278470-136278492 CCCCAGTGAGTGCCCTGACTCCT No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data
1062379151_1062379160 21 Left 1062379151 9:136278442-136278464 CCTGGCTGGACAGAGACTGCAGG No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data
1062379150_1062379160 22 Left 1062379150 9:136278441-136278463 CCCTGGCTGGACAGAGACTGCAG No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data
1062379154_1062379160 -8 Left 1062379154 9:136278471-136278493 CCCAGTGAGTGCCCTGACTCCTC No data
Right 1062379160 9:136278486-136278508 GACTCCTCTAGCAATGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379160 Original CRISPR GACTCCTCTAGCAATGGGTG AGG Intergenic
No off target data available for this crispr