ID: 1062379569

View in Genome Browser
Species Human (GRCh38)
Location 9:136280767-136280789
Sequence TGAGGAAGGCCTGGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379569_1062379588 20 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379569_1062379585 10 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379585 9:136280800-136280822 CTGCCAGCCAAGGAGGGTGCAGG No data
1062379569_1062379581 4 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379581 9:136280794-136280816 TCCCCGCTGCCAGCCAAGGAGGG No data
1062379569_1062379578 0 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379578 9:136280790-136280812 GGCCTCCCCGCTGCCAGCCAAGG No data
1062379569_1062379580 3 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379569_1062379590 22 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379590 9:136280812-136280834 GAGGGTGCAGGTTGTATCTGGGG No data
1062379569_1062379589 21 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379589 9:136280811-136280833 GGAGGGTGCAGGTTGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379569 Original CRISPR TGAGGAAGGCCTGGGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr