ID: 1062379574

View in Genome Browser
Species Human (GRCh38)
Location 9:136280775-136280797
Sequence GGGAGGCCTGAGGAAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379574_1062379592 24 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379592 9:136280822-136280844 GTTGTATCTGGGGCTGCTCTGGG No data
1062379574_1062379588 12 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379574_1062379590 14 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379590 9:136280812-136280834 GAGGGTGCAGGTTGTATCTGGGG No data
1062379574_1062379578 -8 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379578 9:136280790-136280812 GGCCTCCCCGCTGCCAGCCAAGG No data
1062379574_1062379580 -5 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379574_1062379591 23 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379574_1062379585 2 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379585 9:136280800-136280822 CTGCCAGCCAAGGAGGGTGCAGG No data
1062379574_1062379593 25 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379593 9:136280823-136280845 TTGTATCTGGGGCTGCTCTGGGG No data
1062379574_1062379581 -4 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379581 9:136280794-136280816 TCCCCGCTGCCAGCCAAGGAGGG No data
1062379574_1062379589 13 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379589 9:136280811-136280833 GGAGGGTGCAGGTTGTATCTGGG No data
1062379574_1062379594 28 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379594 9:136280826-136280848 TATCTGGGGCTGCTCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379574 Original CRISPR GGGAGGCCTGAGGAAGGCCT GGG (reversed) Intergenic