ID: 1062379577

View in Genome Browser
Species Human (GRCh38)
Location 9:136280785-136280807
Sequence GCTGGCAGCGGGGAGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379577_1062379597 28 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379597 9:136280836-136280858 TGCTCTGGGGTGGTGGTCCAGGG No data
1062379577_1062379585 -8 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379585 9:136280800-136280822 CTGCCAGCCAAGGAGGGTGCAGG No data
1062379577_1062379588 2 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379577_1062379595 21 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379595 9:136280829-136280851 CTGGGGCTGCTCTGGGGTGGTGG No data
1062379577_1062379594 18 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379594 9:136280826-136280848 TATCTGGGGCTGCTCTGGGGTGG No data
1062379577_1062379589 3 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379589 9:136280811-136280833 GGAGGGTGCAGGTTGTATCTGGG No data
1062379577_1062379596 27 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379596 9:136280835-136280857 CTGCTCTGGGGTGGTGGTCCAGG No data
1062379577_1062379591 13 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379577_1062379590 4 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379590 9:136280812-136280834 GAGGGTGCAGGTTGTATCTGGGG No data
1062379577_1062379592 14 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379592 9:136280822-136280844 GTTGTATCTGGGGCTGCTCTGGG No data
1062379577_1062379593 15 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379593 9:136280823-136280845 TTGTATCTGGGGCTGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379577 Original CRISPR GCTGGCAGCGGGGAGGCCTG AGG (reversed) Intergenic
No off target data available for this crispr