ID: 1062379579

View in Genome Browser
Species Human (GRCh38)
Location 9:136280792-136280814
Sequence CTCCTTGGCTGGCAGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379579_1062379599 27 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379579_1062379596 20 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379596 9:136280835-136280857 CTGCTCTGGGGTGGTGGTCCAGG No data
1062379579_1062379589 -4 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379589 9:136280811-136280833 GGAGGGTGCAGGTTGTATCTGGG No data
1062379579_1062379600 28 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379600 9:136280843-136280865 GGGTGGTGGTCCAGGGTTAGGGG No data
1062379579_1062379592 7 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379592 9:136280822-136280844 GTTGTATCTGGGGCTGCTCTGGG No data
1062379579_1062379588 -5 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379579_1062379597 21 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379597 9:136280836-136280858 TGCTCTGGGGTGGTGGTCCAGGG No data
1062379579_1062379598 26 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379598 9:136280841-136280863 TGGGGTGGTGGTCCAGGGTTAGG No data
1062379579_1062379594 11 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379594 9:136280826-136280848 TATCTGGGGCTGCTCTGGGGTGG No data
1062379579_1062379595 14 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379595 9:136280829-136280851 CTGGGGCTGCTCTGGGGTGGTGG No data
1062379579_1062379593 8 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379593 9:136280823-136280845 TTGTATCTGGGGCTGCTCTGGGG No data
1062379579_1062379590 -3 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379590 9:136280812-136280834 GAGGGTGCAGGTTGTATCTGGGG No data
1062379579_1062379591 6 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379579 Original CRISPR CTCCTTGGCTGGCAGCGGGG AGG (reversed) Intergenic
No off target data available for this crispr