ID: 1062379580

View in Genome Browser
Species Human (GRCh38)
Location 9:136280793-136280815
Sequence CTCCCCGCTGCCAGCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379570_1062379580 2 Left 1062379570 9:136280768-136280790 CCACTCCCCCAGGCCTTCCTCAG No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379566_1062379580 15 Left 1062379566 9:136280755-136280777 CCTGGGGCTCCGCCCACTCCCCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379575_1062379580 -6 Left 1062379575 9:136280776-136280798 CCAGGCCTTCCTCAGGCCTCCCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379574_1062379580 -5 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379572_1062379580 -3 Left 1062379572 9:136280773-136280795 CCCCCAGGCCTTCCTCAGGCCTC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379565_1062379580 30 Left 1062379565 9:136280740-136280762 CCTGCAGCAGGAACACCTGGGGC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379569_1062379580 3 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379568_1062379580 6 Left 1062379568 9:136280764-136280786 CCGCCCACTCCCCCAGGCCTTCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data
1062379573_1062379580 -4 Left 1062379573 9:136280774-136280796 CCCCAGGCCTTCCTCAGGCCTCC No data
Right 1062379580 9:136280793-136280815 CTCCCCGCTGCCAGCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379580 Original CRISPR CTCCCCGCTGCCAGCCAAGG AGG Intergenic