ID: 1062379586

View in Genome Browser
Species Human (GRCh38)
Location 9:136280803-136280825
Sequence CAACCTGCACCCTCCTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379586_1062379591 -5 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379586_1062379601 21 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379601 9:136280847-136280869 GGTGGTCCAGGGTTAGGGGTTGG No data
1062379586_1062379606 28 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG No data
1062379586_1062379595 3 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379595 9:136280829-136280851 CTGGGGCTGCTCTGGGGTGGTGG No data
1062379586_1062379599 16 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379586_1062379605 27 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379605 9:136280853-136280875 CCAGGGTTAGGGGTTGGATGGGG No data
1062379586_1062379603 26 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379603 9:136280852-136280874 TCCAGGGTTAGGGGTTGGATGGG No data
1062379586_1062379598 15 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379598 9:136280841-136280863 TGGGGTGGTGGTCCAGGGTTAGG No data
1062379586_1062379597 10 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379597 9:136280836-136280858 TGCTCTGGGGTGGTGGTCCAGGG No data
1062379586_1062379594 0 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379594 9:136280826-136280848 TATCTGGGGCTGCTCTGGGGTGG No data
1062379586_1062379602 25 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379602 9:136280851-136280873 GTCCAGGGTTAGGGGTTGGATGG No data
1062379586_1062379600 17 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379600 9:136280843-136280865 GGGTGGTGGTCCAGGGTTAGGGG No data
1062379586_1062379593 -3 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379593 9:136280823-136280845 TTGTATCTGGGGCTGCTCTGGGG No data
1062379586_1062379596 9 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379596 9:136280835-136280857 CTGCTCTGGGGTGGTGGTCCAGG No data
1062379586_1062379592 -4 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379592 9:136280822-136280844 GTTGTATCTGGGGCTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379586 Original CRISPR CAACCTGCACCCTCCTTGGC TGG (reversed) Intergenic