ID: 1062379587

View in Genome Browser
Species Human (GRCh38)
Location 9:136280807-136280829
Sequence GATACAACCTGCACCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379587_1062379598 11 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379598 9:136280841-136280863 TGGGGTGGTGGTCCAGGGTTAGG No data
1062379587_1062379599 12 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379587_1062379603 22 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379603 9:136280852-136280874 TCCAGGGTTAGGGGTTGGATGGG No data
1062379587_1062379591 -9 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379587_1062379592 -8 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379592 9:136280822-136280844 GTTGTATCTGGGGCTGCTCTGGG No data
1062379587_1062379600 13 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379600 9:136280843-136280865 GGGTGGTGGTCCAGGGTTAGGGG No data
1062379587_1062379606 24 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG No data
1062379587_1062379595 -1 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379595 9:136280829-136280851 CTGGGGCTGCTCTGGGGTGGTGG No data
1062379587_1062379602 21 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379602 9:136280851-136280873 GTCCAGGGTTAGGGGTTGGATGG No data
1062379587_1062379605 23 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379605 9:136280853-136280875 CCAGGGTTAGGGGTTGGATGGGG No data
1062379587_1062379601 17 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379601 9:136280847-136280869 GGTGGTCCAGGGTTAGGGGTTGG No data
1062379587_1062379596 5 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379596 9:136280835-136280857 CTGCTCTGGGGTGGTGGTCCAGG No data
1062379587_1062379594 -4 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379594 9:136280826-136280848 TATCTGGGGCTGCTCTGGGGTGG No data
1062379587_1062379597 6 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379597 9:136280836-136280858 TGCTCTGGGGTGGTGGTCCAGGG No data
1062379587_1062379593 -7 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379593 9:136280823-136280845 TTGTATCTGGGGCTGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379587 Original CRISPR GATACAACCTGCACCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr