ID: 1062379588

View in Genome Browser
Species Human (GRCh38)
Location 9:136280810-136280832
Sequence AGGAGGGTGCAGGTTGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379579_1062379588 -5 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379575_1062379588 11 Left 1062379575 9:136280776-136280798 CCAGGCCTTCCTCAGGCCTCCCC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379574_1062379588 12 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379572_1062379588 14 Left 1062379572 9:136280773-136280795 CCCCCAGGCCTTCCTCAGGCCTC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379568_1062379588 23 Left 1062379568 9:136280764-136280786 CCGCCCACTCCCCCAGGCCTTCC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379584_1062379588 -10 Left 1062379584 9:136280797-136280819 CCGCTGCCAGCCAAGGAGGGTGC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379577_1062379588 2 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379570_1062379588 19 Left 1062379570 9:136280768-136280790 CCACTCCCCCAGGCCTTCCTCAG No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379582_1062379588 -8 Left 1062379582 9:136280795-136280817 CCCCGCTGCCAGCCAAGGAGGGT No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379576_1062379588 6 Left 1062379576 9:136280781-136280803 CCTTCCTCAGGCCTCCCCGCTGC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379573_1062379588 13 Left 1062379573 9:136280774-136280796 CCCCAGGCCTTCCTCAGGCCTCC No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379583_1062379588 -9 Left 1062379583 9:136280796-136280818 CCCGCTGCCAGCCAAGGAGGGTG No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data
1062379569_1062379588 20 Left 1062379569 9:136280767-136280789 CCCACTCCCCCAGGCCTTCCTCA No data
Right 1062379588 9:136280810-136280832 AGGAGGGTGCAGGTTGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379588 Original CRISPR AGGAGGGTGCAGGTTGTATC TGG Intergenic
No off target data available for this crispr