ID: 1062379591

View in Genome Browser
Species Human (GRCh38)
Location 9:136280821-136280843
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379572_1062379591 25 Left 1062379572 9:136280773-136280795 CCCCCAGGCCTTCCTCAGGCCTC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379570_1062379591 30 Left 1062379570 9:136280768-136280790 CCACTCCCCCAGGCCTTCCTCAG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379586_1062379591 -5 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379583_1062379591 2 Left 1062379583 9:136280796-136280818 CCCGCTGCCAGCCAAGGAGGGTG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379584_1062379591 1 Left 1062379584 9:136280797-136280819 CCGCTGCCAGCCAAGGAGGGTGC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379587_1062379591 -9 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379573_1062379591 24 Left 1062379573 9:136280774-136280796 CCCCAGGCCTTCCTCAGGCCTCC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379574_1062379591 23 Left 1062379574 9:136280775-136280797 CCCAGGCCTTCCTCAGGCCTCCC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379577_1062379591 13 Left 1062379577 9:136280785-136280807 CCTCAGGCCTCCCCGCTGCCAGC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379576_1062379591 17 Left 1062379576 9:136280781-136280803 CCTTCCTCAGGCCTCCCCGCTGC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379575_1062379591 22 Left 1062379575 9:136280776-136280798 CCAGGCCTTCCTCAGGCCTCCCC No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379582_1062379591 3 Left 1062379582 9:136280795-136280817 CCCCGCTGCCAGCCAAGGAGGGT No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data
1062379579_1062379591 6 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379591 9:136280821-136280843 GGTTGTATCTGGGGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379591 Original CRISPR GGTTGTATCTGGGGCTGCTC TGG Intergenic