ID: 1062379599

View in Genome Browser
Species Human (GRCh38)
Location 9:136280842-136280864
Sequence GGGGTGGTGGTCCAGGGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379579_1062379599 27 Left 1062379579 9:136280792-136280814 CCTCCCCGCTGCCAGCCAAGGAG No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379582_1062379599 24 Left 1062379582 9:136280795-136280817 CCCCGCTGCCAGCCAAGGAGGGT No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379586_1062379599 16 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379583_1062379599 23 Left 1062379583 9:136280796-136280818 CCCGCTGCCAGCCAAGGAGGGTG No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379587_1062379599 12 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data
1062379584_1062379599 22 Left 1062379584 9:136280797-136280819 CCGCTGCCAGCCAAGGAGGGTGC No data
Right 1062379599 9:136280842-136280864 GGGGTGGTGGTCCAGGGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379599 Original CRISPR GGGGTGGTGGTCCAGGGTTA GGG Intergenic
No off target data available for this crispr