ID: 1062379602 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:136280851-136280873 |
Sequence | GTCCAGGGTTAGGGGTTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062379586_1062379602 | 25 | Left | 1062379586 | 9:136280803-136280825 | CCAGCCAAGGAGGGTGCAGGTTG | No data | ||
Right | 1062379602 | 9:136280851-136280873 | GTCCAGGGTTAGGGGTTGGATGG | No data | ||||
1062379587_1062379602 | 21 | Left | 1062379587 | 9:136280807-136280829 | CCAAGGAGGGTGCAGGTTGTATC | No data | ||
Right | 1062379602 | 9:136280851-136280873 | GTCCAGGGTTAGGGGTTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062379602 | Original CRISPR | GTCCAGGGTTAGGGGTTGGA TGG | Intergenic | ||