ID: 1062379606

View in Genome Browser
Species Human (GRCh38)
Location 9:136280854-136280876
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062379586_1062379606 28 Left 1062379586 9:136280803-136280825 CCAGCCAAGGAGGGTGCAGGTTG No data
Right 1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG No data
1062379587_1062379606 24 Left 1062379587 9:136280807-136280829 CCAAGGAGGGTGCAGGTTGTATC No data
Right 1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062379606 Original CRISPR CAGGGTTAGGGGTTGGATGG GGG Intergenic