ID: 1062381659

View in Genome Browser
Species Human (GRCh38)
Location 9:136289891-136289913
Sequence GGGGGGGCCAAGAACAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062381659_1062381676 30 Left 1062381659 9:136289891-136289913 CCAGAACTGTTCTTGGCCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1062381676 9:136289944-136289966 CACTTTCACACCCACCTGCCTGG 0: 1
1: 0
2: 2
3: 30
4: 414
1062381659_1062381661 -8 Left 1062381659 9:136289891-136289913 CCAGAACTGTTCTTGGCCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1062381661 9:136289906-136289928 GCCCCCCCCAAGGCCCCGCCCGG 0: 1
1: 0
2: 4
3: 44
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062381659 Original CRISPR GGGGGGGCCAAGAACAGTTC TGG (reversed) Intronic
901630773 1:10647122-10647144 GGGGGGACGGAGAACAGTGCTGG + Intronic
903384218 1:22916229-22916251 GTGGGGCCCCAGAACAGTTGGGG - Intergenic
909323864 1:74324644-74324666 AGTGGGGCCAGGGACAGTTCAGG + Intronic
916049468 1:161025550-161025572 GGGTGGGGGAAGAACAGTTATGG + Intronic
916238308 1:162612982-162613004 GGGATGGCAAAGAGCAGTTCTGG + Intergenic
920534738 1:206730135-206730157 GGAGGGGCTGAGAAAAGTTCTGG - Intronic
922228845 1:223668244-223668266 GGTGGGGAGAAGAACATTTCAGG - Intergenic
923018465 1:230145164-230145186 GGGGGTGCCAAGGACAGTCTTGG - Intronic
924369719 1:243334887-243334909 GGTGGTACCAAGAAAAGTTCTGG - Intronic
1064594080 10:16925679-16925701 GGACGTGCCAAGAACAGTTGAGG + Exonic
1067312766 10:45129982-45130004 GGACGTGCCAAGAACAGTTGAGG - Intergenic
1072026549 10:91465237-91465259 AGGGAGGCTAAAAACAGTTCTGG + Intronic
1074587122 10:114778745-114778767 GGGAGGGACAAGAACACTCCTGG - Intergenic
1076585390 10:131543793-131543815 GGGGAGACCAAGTACAGTCCAGG + Intergenic
1077128407 11:955808-955830 GGGGGAGGCAAGATCAGTTTTGG + Intronic
1081964405 11:47160968-47160990 AGAGGGGCCAAGAACAGTCACGG - Intronic
1082000398 11:47391022-47391044 CTGGGGCCCAAGAACAGTGCAGG + Intergenic
1083605161 11:63974347-63974369 GGAGGAGTCAAGAACAGTTTAGG + Intergenic
1083623060 11:64058463-64058485 GGGTGGGCGAAGAGCAGGTCAGG + Intronic
1083720240 11:64600312-64600334 GGGGGGCCCAAGATCAGATGAGG - Intronic
1083724092 11:64619372-64619394 GGGGTGGCCAAGAGCAGCTGGGG - Intronic
1084805199 11:71573905-71573927 GGGGAGGCTTAGAACAGTTGTGG - Intergenic
1085200500 11:74699049-74699071 GGGGGGTCCATGGACAGTGCTGG - Intronic
1086407393 11:86510038-86510060 GTGGAGGTCAAGAACAGTTTGGG - Intronic
1096784636 12:54009905-54009927 GGGGGTGCCTAGAACATTTAGGG + Intronic
1097265385 12:57741330-57741352 GAGGGGACCAAGAAGAGTTCTGG + Intronic
1100357535 12:93845315-93845337 GGGAGAGCAAAGAGCAGTTCTGG + Intronic
1102354232 12:112219415-112219437 GTGGGGGCCGAGCACAGTCCCGG + Exonic
1104025910 12:125026181-125026203 GGAGGGGCCAAGAAATGTCCTGG + Exonic
1107703894 13:43079653-43079675 TGGGAGGCCAATAAAAGTTCAGG - Intronic
1110560533 13:76906828-76906850 TGGGGGCCCAACAACAGTCCAGG - Intergenic
1114614230 14:24059793-24059815 GGGTGGGGCAAGAGTAGTTCAGG - Intronic
1119089779 14:71770932-71770954 GGTGGCTCCAAGAACAGATCTGG - Intergenic
1121719596 14:96100160-96100182 GGAGGGGACAAGAACACTACTGG + Intergenic
1125503052 15:40251573-40251595 GCGGGGACCAAGGACAGTGCAGG - Exonic
1128154899 15:65385981-65386003 GGGGGGGCCAAGCCGAGCTCTGG + Exonic
1128675529 15:69605602-69605624 GGGGAGGGCTAGAACAGTTAGGG + Intergenic
1128750752 15:70147482-70147504 GGAGGGACCAAGAAGAGATCAGG - Intergenic
1129076350 15:72999661-72999683 TGGAGGTCCAAGAGCAGTTCCGG + Intergenic
1129472699 15:75764168-75764190 GGGGGAGCCAAGGATAGTCCTGG + Intergenic
1130984522 15:88836387-88836409 GGTGGGGCCAGGAAAAGTCCAGG - Intronic
1131872699 15:96778212-96778234 AAGGGGGCCAAGAAGAGTTGGGG - Intergenic
1132696606 16:1204866-1204888 GTGGGGGCCCAGATCAGTGCCGG + Intronic
1132756622 16:1488372-1488394 GCGGGGTCCACGGACAGTTCCGG - Exonic
1132954130 16:2582210-2582232 GGGGGGGCGGGGAACAGTACGGG - Intronic
1132960215 16:2617953-2617975 GGGGGGGCGGGGAACAGTACGGG + Intergenic
1134112293 16:11523253-11523275 GGGAGGACCAAGGCCAGTTCTGG - Intronic
1137772785 16:51030421-51030443 GGGGAGGCCAAGAACTCTCCTGG - Intergenic
1140730779 16:77853898-77853920 TGGGAGGCCAAGGAGAGTTCAGG + Intronic
1141278672 16:82610639-82610661 GGATTGGCCAAGAGCAGTTCAGG + Intergenic
1141625652 16:85259755-85259777 GGGGGGTCCCAGTACAGTGCAGG - Intergenic
1143614803 17:8043352-8043374 GTGGGGGCAGAGAGCAGTTCGGG + Intronic
1145072325 17:19821430-19821452 GGGGGGGCCTAGAATTTTTCTGG + Intronic
1145201624 17:20950674-20950696 CAGTGGGCAAAGAACAGTTCTGG - Intergenic
1147790545 17:43012014-43012036 GAGGGGGCCAAGACCAGCCCAGG + Intronic
1151421506 17:74001038-74001060 GGGGGTGACCAGAACAGTTCTGG - Intergenic
1152608440 17:81304331-81304353 GGGGCGGCCCAGGACAGTCCGGG + Intergenic
1152791782 17:82283927-82283949 GGGAGGGCCCAGCACAGTGCGGG + Intergenic
1155978925 18:32160754-32160776 CAGGGTGCCCAGAACAGTTCAGG + Intronic
1156493726 18:37512115-37512137 GGGAGGGCCAGGGACAGTTGGGG + Intronic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1156630952 18:38967841-38967863 AAGGGGGCCAATAACAGCTCAGG + Intergenic
1161950136 19:7463320-7463342 GGTGGGGACAAGAACATTCCAGG - Intronic
1162931429 19:13959689-13959711 GGGCGGGCCAAGGACAGTCCCGG + Intronic
1165247299 19:34504959-34504981 GTGGGGATCAAGAACAGGTCTGG + Exonic
1165933018 19:39372563-39372585 GGTGCTGCCAAGAACAGATCAGG + Intronic
1168367999 19:55805901-55805923 TTGTTGGCCAAGAACAGTTCTGG - Intronic
934854352 2:97719557-97719579 GGGGGGGCGCAGACCAGGTCTGG + Intronic
936087962 2:109482337-109482359 AGTGGGGCTAAGAGCAGTTCAGG + Intronic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
937842335 2:126536269-126536291 GAGGGGGCCATGCACAGATCTGG + Intergenic
940610165 2:155980188-155980210 GAGGGGGCCCAGCTCAGTTCTGG + Intergenic
946302185 2:218830724-218830746 GGTGAGGCCAAGGCCAGTTCTGG - Exonic
947817108 2:233044994-233045016 GGAGGTGCCCAGAACAGTTGCGG - Intergenic
1174462380 20:50691825-50691847 GGGGTGGCCAAGAGCAGTTTAGG - Intergenic
1181731468 22:24849990-24850012 GGGTGGGCCAAGAAGAGTCTTGG - Intronic
1181739593 22:24910239-24910261 GGGGGGGTAAAGAAATGTTCTGG + Intronic
1184231589 22:43161139-43161161 TGGGGGGCCATGCCCAGTTCAGG - Exonic
1184631915 22:45788312-45788334 GGGAGGGCAAAGAAAAGATCTGG - Intronic
1185235614 22:49711044-49711066 TGGGAGTCCAAGAACAGCTCTGG + Intergenic
1185344239 22:50304456-50304478 GGGGGAGCCCAGAACAGTGCAGG + Intronic
950878774 3:16304409-16304431 GCTGGTGCCAAGAACAATTCTGG - Exonic
953780661 3:45867381-45867403 GCAGGAGCCAAGGACAGTTCTGG - Intronic
960989883 3:123303463-123303485 GGTGGGGCCAGGAAGAGTTTAGG - Intronic
968192335 3:196677896-196677918 GGGGGAGTCAAGAACAGTGGAGG - Intronic
968454461 4:689885-689907 GGGTGGGCCAGGCACAGTTGTGG - Intergenic
983259294 4:165438141-165438163 GGAGGAGGCAAGATCAGTTCTGG + Intronic
985748207 5:1659794-1659816 GGGGGCCCCAAGAACAGATGTGG + Intergenic
986151633 5:5135191-5135213 GGAGGGGCCAAGAGCAGGGCTGG + Intergenic
990962992 5:61414383-61414405 GAGGGGGAAAAGAACAGTTTTGG + Intronic
997511203 5:134455817-134455839 GCGGGGGCCACCAACAGTTCTGG + Intergenic
998157976 5:139796803-139796825 GGGGGGGCCAGGAAGAGAACAGG + Intronic
1004924196 6:20402874-20402896 GGGGGGGCCGCGAAAAGTTTTGG - Intronic
1008471086 6:51886103-51886125 GGGGTAGGCAAGAACAGTTAGGG - Intronic
1018029725 6:159832317-159832339 GGGGAAGCCAAGAACCCTTCCGG + Intergenic
1018639626 6:165894546-165894568 CGGGGAGCCAAGAGTAGTTCTGG + Intronic
1022089638 7:27098885-27098907 GCGGATGCCATGAACAGTTCAGG - Intergenic
1025247041 7:57325293-57325315 AGGAGGCCCAAGAACAGTTCTGG - Intergenic
1027917280 7:84341596-84341618 GAGGGGATCAAGAACTGTTCAGG - Intronic
1031177239 7:118368787-118368809 AGTGGGGCCTAGAACAGCTCTGG - Intergenic
1032724363 7:134577130-134577152 GAGGGGGCCAAAGACAGTGCAGG - Intronic
1036656318 8:10679619-10679641 GGAGGGGCCAAGATCAGCTCTGG - Intronic
1039458367 8:37723322-37723344 GGGCTGGCCAAGAAGATTTCTGG - Intergenic
1047621700 8:126614136-126614158 GGCAGCACCAAGAACAGTTCAGG - Intergenic
1053379554 9:37637081-37637103 CGGCGGGCCAGGAACGGTTCTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061725293 9:132579267-132579289 GAGGGGGCCAAGAATTGCTCAGG + Intergenic
1062381659 9:136289891-136289913 GGGGGGGCCAAGAACAGTTCTGG - Intronic
1189173384 X:38931120-38931142 CTGGGGGCCAGGAACAGTTGTGG - Intergenic
1192542885 X:71990106-71990128 GTGGGGGACAAAAAGAGTTCGGG + Intergenic
1195715986 X:107819194-107819216 GAGGGGCCCAAGTACAGCTCAGG + Intergenic
1196498551 X:116350901-116350923 AGGGGGCCCATGAACAGCTCAGG + Intergenic
1199237011 X:145504016-145504038 AGGGCGGCCAAGAAGAGATCTGG + Intergenic
1199856822 X:151766041-151766063 GGAGGGGCCAAGAACAGTGGTGG - Intergenic