ID: 1062381717

View in Genome Browser
Species Human (GRCh38)
Location 9:136290085-136290107
Sequence GGGCGTGTGGTCTTCCCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062381717_1062381722 1 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381722 9:136290109-136290131 GTTCTCTCAGCCTCAGAGCTAGG 0: 1
1: 0
2: 0
3: 30
4: 239
1062381717_1062381727 20 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381727 9:136290128-136290150 TAGGCCTTGACCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1062381717_1062381725 18 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381725 9:136290126-136290148 GCTAGGCCTTGACCTCCCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 141
1062381717_1062381726 19 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381726 9:136290127-136290149 CTAGGCCTTGACCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
1062381717_1062381724 17 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381724 9:136290125-136290147 AGCTAGGCCTTGACCTCCCTTGG 0: 1
1: 0
2: 1
3: 14
4: 191
1062381717_1062381729 27 Left 1062381717 9:136290085-136290107 CCGCTCGGGAAGACCACACGCCC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1062381729 9:136290135-136290157 TGACCTCCCTTGGGGGTCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062381717 Original CRISPR GGGCGTGTGGTCTTCCCGAG CGG (reversed) Intronic
901145266 1:7060620-7060642 GGGCTTGTGCTTTTCCCAAGGGG - Intronic
901696841 1:11013837-11013859 GGGCGTGTGGGCTTCGCTACAGG + Exonic
903292778 1:22325410-22325432 GGAGGTGTGTTCTTCCTGAGTGG + Intergenic
908534734 1:65067054-65067076 GTGCGTGTGTTTTTCCCGAGGGG - Intergenic
1077131891 11:977176-977198 GGGCGACTGGACATCCCGAGTGG + Exonic
1081911099 11:46700518-46700540 GGGCGCGGGGTCTCCCCGGGTGG - Intronic
1094840067 12:34339142-34339164 GTGCGTGTGGGCTTCGCCAGGGG - Intergenic
1103509112 12:121462102-121462124 GGGCCTGTGGCCTTCCCTTGTGG - Intronic
1103611655 12:122127784-122127806 GGGAATGTGGTCTGCCCTAGGGG + Intronic
1105449065 13:20482638-20482660 GGGAGTGTGGTTTTCCCCAGTGG - Intronic
1121330258 14:93045213-93045235 GGGCCTGAGGTCTTGCCCAGAGG - Intronic
1122207335 14:100154510-100154532 GGAGGTGGGGTCTTCCCTAGGGG + Intronic
1127435841 15:58957414-58957436 TGGCGTCTGGTCTTCCCTAGAGG + Intronic
1132512986 16:353180-353202 GGTCGCGCCGTCTTCCCGAGGGG + Intergenic
1138337406 16:56264041-56264063 AGGCCTGAGGTCTTCCCAAGAGG + Intronic
1142307920 16:89295784-89295806 GGGGCTGTGACCTTCCCGAGGGG + Intronic
1142573335 17:889949-889971 GGGCGTGTGCTCTTTGTGAGTGG - Intronic
1160356697 18:78233039-78233061 GTGTGTGTGGCCTTCCCCAGCGG - Intergenic
1163190960 19:15676173-15676195 GGGTGGGTGGACTTCCAGAGGGG + Intronic
1163435741 19:17294171-17294193 GGGCGTGCTTTCTTCCCGAGGGG - Intronic
928184291 2:29095559-29095581 GGGGCTGTGGTCCTCCGGAGAGG - Intergenic
938474104 2:131591476-131591498 GGGCGTGGGGTCGCCCCCAGGGG + Intergenic
945296284 2:208174456-208174478 AGGAGGGTGGTCATCCCGAGTGG + Intronic
946416380 2:219542046-219542068 GAGCGTGTGGTGTTCCTGACGGG - Exonic
948508572 2:238448087-238448109 GGCTGTGTGCTGTTCCCGAGGGG + Exonic
1170756661 20:19212028-19212050 CAGCGTGTGTGCTTCCCGAGAGG + Intergenic
1178113932 21:29397920-29397942 GAGCGTGTGGTCTTTCTGAAAGG + Intronic
1181107028 22:20581634-20581656 GGGCGTCTGGCCTCCCCTAGAGG - Intronic
1181806467 22:25377464-25377486 GGGCGTGGGGTTTTCCTGTGGGG - Intronic
1184846616 22:47091544-47091566 GGGGGTGTGGCCTTGCGGAGGGG + Intronic
954677594 3:52324387-52324409 GGGTGTGGGGCCTTCCCCAGTGG + Intronic
959065864 3:101656803-101656825 GGGCCTCTGGTCTTCCCATGTGG - Intronic
985545387 5:506442-506464 GGGCCCGGGGTCCTCCCGAGGGG + Intronic
990761202 5:59131524-59131546 GGGCGTGTGGTATTCCAAAAGGG + Intronic
997581461 5:135019929-135019951 GGGCTTCTGGACTCCCCGAGGGG + Intergenic
1019537862 7:1538359-1538381 GGGGGTGTGGGGTTCCTGAGGGG - Intronic
1019548562 7:1590890-1590912 GGGCGTGGAGGCTTCCGGAGAGG + Intergenic
1026980529 7:74524015-74524037 GGGCGTGTGACCGTCCCGTGGGG + Intronic
1029708719 7:102288141-102288163 GGGGGTGTGGTTTCCCCAAGAGG + Intronic
1032836168 7:135676704-135676726 GTGTGTGTGGTCTCCCAGAGTGG + Intronic
1039790433 8:40871648-40871670 GTGAGTTTGGTCTTCCCAAGAGG + Intronic
1040081745 8:43292280-43292302 GGGCGTGGGCTCTCCCCGGGTGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051604896 9:18909234-18909256 GAGCCTGTGGTGTTCCCCAGTGG + Exonic
1062352797 9:136147485-136147507 GGGCTTGTGGTCTTCCAGGCTGG + Intergenic
1062381717 9:136290085-136290107 GGGCGTGTGGTCTTCCCGAGCGG - Intronic
1062629809 9:137458676-137458698 GGGTGTGTGGGCTCCCGGAGGGG - Intronic
1201861914 Y:18607804-18607826 GGGAGTGTGATCTTCTCTAGTGG + Intergenic
1201871409 Y:18712576-18712598 GGGAGTGTGATCTTCTCTAGTGG - Intergenic