ID: 1062386612

View in Genome Browser
Species Human (GRCh38)
Location 9:136314374-136314396
Sequence CTTCCCCCCACCACGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062386607_1062386612 0 Left 1062386607 9:136314351-136314373 CCACAATAGAGGGGTGTGATGTG No data
Right 1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG No data
1062386606_1062386612 1 Left 1062386606 9:136314350-136314372 CCCACAATAGAGGGGTGTGATGT No data
Right 1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062386612 Original CRISPR CTTCCCCCCACCACGGGGGC AGG Intergenic
No off target data available for this crispr