ID: 1062388213

View in Genome Browser
Species Human (GRCh38)
Location 9:136323367-136323389
Sequence GCCTCCCACCGCAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062388206_1062388213 19 Left 1062388206 9:136323325-136323347 CCCTCCTCATCCTGTTTGGTTTG 0: 1
1: 1
2: 3
3: 31
4: 332
Right 1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG 0: 1
1: 0
2: 1
3: 33
4: 408
1062388208_1062388213 15 Left 1062388208 9:136323329-136323351 CCTCATCCTGTTTGGTTTGAGCT 0: 1
1: 0
2: 2
3: 12
4: 174
Right 1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG 0: 1
1: 0
2: 1
3: 33
4: 408
1062388204_1062388213 27 Left 1062388204 9:136323317-136323339 CCGATTTGCCCTCCTCATCCTGT 0: 1
1: 0
2: 2
3: 21
4: 351
Right 1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG 0: 1
1: 0
2: 1
3: 33
4: 408
1062388209_1062388213 9 Left 1062388209 9:136323335-136323357 CCTGTTTGGTTTGAGCTGATGTT 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG 0: 1
1: 0
2: 1
3: 33
4: 408
1062388207_1062388213 18 Left 1062388207 9:136323326-136323348 CCTCCTCATCCTGTTTGGTTTGA 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG 0: 1
1: 0
2: 1
3: 33
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062388213 Original CRISPR GCCTCCCACCGCAGACCCGG GGG Intergenic