ID: 1062388948

View in Genome Browser
Species Human (GRCh38)
Location 9:136326603-136326625
Sequence AAGGCCCAGGATGCTGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062388932_1062388948 28 Left 1062388932 9:136326552-136326574 CCCGGGGTCGCAGCTGCCTTTCA 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1062388937_1062388948 12 Left 1062388937 9:136326568-136326590 CCTTTCAAGGGCCTGGAGTCTCC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1062388933_1062388948 27 Left 1062388933 9:136326553-136326575 CCGGGGTCGCAGCTGCCTTTCAA 0: 1
1: 0
2: 1
3: 4
4: 139
Right 1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1062388938_1062388948 1 Left 1062388938 9:136326579-136326601 CCTGGAGTCTCCTGACACCACCG 0: 1
1: 0
2: 2
3: 9
4: 125
Right 1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1062388941_1062388948 -9 Left 1062388941 9:136326589-136326611 CCTGACACCACCGGAAGGCCCAG 0: 1
1: 0
2: 2
3: 11
4: 142
Right 1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062388948 Original CRISPR AAGGCCCAGGATGCTGTCGG GGG Intergenic
900493027 1:2962197-2962219 AGCGCCCAGGCTGCTGTCTGGGG - Intergenic
900498459 1:2987750-2987772 AAGGCCAAGGATGCTGTGATGGG - Intergenic
900885726 1:5414060-5414082 GATGCCCAGGATGCTGGAGGGGG - Intergenic
902741540 1:18441984-18442006 AGGGCCCAGGAAGCAGTTGGGGG + Intergenic
904441328 1:30533962-30533984 AAAGCCCAGGATGCAGTGGATGG - Intergenic
905649257 1:39645635-39645657 ATGGCCCAGGATGAAGTAGGGGG + Intergenic
906431748 1:45760896-45760918 AAGGCCTAGGGGCCTGTCGGGGG + Intergenic
909792188 1:79693478-79693500 AAGGCCCTGGATGCTCTCTAGGG - Intergenic
910244437 1:85123432-85123454 AATGACCAGATTGCTGTCGGGGG + Intronic
915900516 1:159843424-159843446 GAGGCCCCTGATGCTGTCTGAGG + Intronic
915900771 1:159845222-159845244 GAGGCCCCTGATGCTGTCTGAGG - Intronic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
921069040 1:211643620-211643642 AAGGCCTAGGGTGCTGACTGTGG - Intergenic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
921699216 1:218248207-218248229 AAGGTCGAGTATGCTGTCAGAGG + Intergenic
922053859 1:222021650-222021672 GAGGCCCATGATGCTGTCACAGG + Intergenic
1063982216 10:11463303-11463325 AAGGCCCTGGATGCTGAGGACGG - Exonic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1067685233 10:48462865-48462887 AAAGGCCAGGACGCTGTCAGTGG - Intronic
1070409189 10:76123763-76123785 AAGGCACAGGATCCTGGCTGAGG + Intronic
1073048794 10:100654971-100654993 AAGGCCCAGGAGGAAGACGGGGG - Intergenic
1076707247 10:132308479-132308501 CAGGCCCGGGATGCGGGCGGCGG + Intronic
1076744320 10:132505102-132505124 AAGGCCCAGGCTGCTGGTGCAGG + Intergenic
1076902255 10:133345576-133345598 AAGGCCCATGATGCCGTCCCAGG + Intronic
1077344217 11:2039007-2039029 AAGGACCCGCATGCTGTCGGGGG - Intergenic
1078391893 11:10942097-10942119 ATGGCCCAGCATGATGTGGGAGG + Intergenic
1079818590 11:25094719-25094741 GAGGCCCAGGGTGCTGAGGGTGG + Intergenic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1082775032 11:57237920-57237942 AAGGCACAGGATGCTTTAGAAGG + Intergenic
1083755957 11:64791878-64791900 AAGGGCCAGGCTGCTGGGGGTGG - Intronic
1084635783 11:70391608-70391630 AAGTCACAGGATGATGTAGGCGG - Intergenic
1085508071 11:77071370-77071392 AAGGCCCAGCACGCTGTCAAAGG - Intronic
1087064165 11:94011764-94011786 AAAGCCCAGGATGATTTGGGAGG + Intergenic
1089289807 11:117430763-117430785 AAGCCCCAGGATGCGGACCGGGG - Exonic
1089522839 11:119077081-119077103 AAGGTGCAGGATGTTGTTGGTGG + Exonic
1089736337 11:120552534-120552556 AGGGCACAGGATGCTGTTGAGGG + Intronic
1089949279 11:122510232-122510254 TAGGCCCAGGATGGTGGCGTGGG + Intergenic
1090120690 11:124023734-124023756 AAGGACCACGATGCAGTGGGAGG - Exonic
1202827203 11_KI270721v1_random:94196-94218 AAGGACCCGCATGCTGTCGGGGG - Intergenic
1098356559 12:69617871-69617893 AAGGCCCAGGATTCTGCCTGTGG - Intergenic
1101223680 12:102666514-102666536 AAGGCCTATGATGGTATCGGAGG - Intergenic
1101557262 12:105821917-105821939 AAGGCCCTGGAAGCTGGCTGGGG + Intergenic
1104792593 12:131493320-131493342 AAGAGAGAGGATGCTGTCGGGGG - Intergenic
1105302534 13:19149307-19149329 AGGGCCAAGGGTGCTGTGGGGGG + Intergenic
1106809836 13:33349466-33349488 AGGGCCAAGGATGCAGTGGGCGG - Intronic
1107692161 13:42964591-42964613 AAGGCTCAGGAGGCTCTCAGAGG + Intronic
1108239122 13:48444118-48444140 GAGGCCTAGGATGGTGTCTGGGG - Intronic
1109145214 13:58771748-58771770 AAGGCTCAGGAGGCTGCAGGTGG - Intergenic
1110196863 13:72799682-72799704 AATGCCCAGGATGGTTTTGGTGG + Intronic
1113195861 13:107804577-107804599 AAGACCCAGCATGCAGTGGGTGG + Intronic
1113784310 13:112994436-112994458 GCTGCCCAGGAGGCTGTCGGTGG + Intronic
1115296128 14:31829118-31829140 AAGGTCCAGGATGCTGTCATGGG + Intronic
1118731440 14:68669798-68669820 AAGGCCCAGGGTTCTGGCTGGGG - Intronic
1120517786 14:85490708-85490730 AAGGCCAGAGATTCTGTCGGAGG + Intergenic
1120693639 14:87620482-87620504 ATTGCCAAGGATGCTGTCAGTGG - Intergenic
1202939751 14_KI270725v1_random:136116-136138 AGGGTCCAGGGTCCTGTCGGGGG - Intergenic
1128553075 15:68610568-68610590 AACGCGCAGGATGCTGGAGGAGG - Intronic
1129111869 15:73341889-73341911 GAGGCCCAGGCTGCTGCTGGGGG + Intronic
1129328749 15:74816151-74816173 CAGGCCCAGGATGGCGTCTGTGG - Exonic
1129356334 15:74994541-74994563 CAGGCCTAGGATGGTGTGGGTGG + Intronic
1132697127 16:1206991-1207013 CATGCCCAGGATGCTGAGGGTGG - Exonic
1132701460 16:1223914-1223936 AAGGCCCGGGGTGCTGGGGGTGG + Intronic
1132752595 16:1465670-1465692 ATGGCCCAGGGTGCTGTGGCGGG - Intronic
1132763993 16:1525274-1525296 GGTGCCCAGGATGCTGTCGGAGG - Exonic
1132871568 16:2117810-2117832 CAGGGCCACGATGCTGTAGGCGG + Exonic
1134520961 16:14919085-14919107 CAGGGCCACGATGCTGTAGGCGG - Intronic
1134708637 16:16317736-16317758 CAGGGCCACGATGCTGTAGGCGG - Intergenic
1134715850 16:16357769-16357791 CAGGGCCACGATGCTGTAGGCGG - Intergenic
1134950967 16:18350909-18350931 CAGGGCCACGATGCTGTAGGCGG + Intergenic
1134958906 16:18394390-18394412 CAGGGCCACGATGCTGTAGGCGG + Intergenic
1135424235 16:22324436-22324458 GAGGCCCAGGCTGCTGCTGGAGG + Intronic
1137057284 16:35751781-35751803 GAGGCCCAGGATCGTGGCGGAGG - Intergenic
1137737550 16:50736186-50736208 CAGGCCCAGGAGGCTTTTGGTGG - Intergenic
1138198893 16:55074423-55074445 AAGGGCCAGGAGGGTGGCGGTGG + Intergenic
1138207689 16:55136851-55136873 AAGGACCAGGATCCTGTGGGAGG + Intergenic
1140204370 16:72921768-72921790 AGGCCCCAGGAAGCTGGCGGGGG + Intronic
1143036705 17:4003762-4003784 AAGCCCCAGACTGCTTTCGGGGG - Intergenic
1143446384 17:7012606-7012628 AAAGCCCAGGATGCCCTCGCAGG - Exonic
1143679888 17:8468420-8468442 AAGGACCAGGATGTTGAGGGCGG + Intronic
1143781223 17:9230662-9230684 CAGGCCCAGGAGGCTCTGGGGGG + Intronic
1144947896 17:18979119-18979141 AAGGCCCTGGACACTGTGGGGGG + Intronic
1147047946 17:37768642-37768664 AAGGTCCAGGATGGTGCCTGAGG - Intergenic
1148122272 17:45220471-45220493 AAGGAGGAGGATGCTGTCAGGGG + Intergenic
1151218317 17:72592665-72592687 AAGGCCCGGGAGGCTTACGGTGG + Intergenic
1152646813 17:81472978-81473000 AAGGCTCAGGAAGCTGCTGGAGG + Intergenic
1153779076 18:8478498-8478520 AAGGACCAGGATGGGGTGGGTGG + Intergenic
1155070785 18:22314122-22314144 GAGGCCCGGGCTGCTGTCTGTGG + Intergenic
1157522135 18:48352578-48352600 AGGGCCCAGGATGCTGACCAGGG + Intronic
1158944851 18:62439153-62439175 AAGGCCCATGAGGCAGTAGGGGG + Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1161328071 19:3672926-3672948 AAGGCCCAGGATGATGAAGCTGG + Intronic
1161478471 19:4498933-4498955 GAGGCGCAGGGTGCAGTCGGGGG + Intronic
1163643131 19:18473155-18473177 AAGGCCCAGGATGCAGGGGCGGG + Intronic
1164977123 19:32581505-32581527 GGGGCCCAGGAGGCTGGCGGCGG + Intronic
1165016635 19:32886012-32886034 AAGGCCTAGGAGGGTGTGGGAGG - Intronic
1166762673 19:45234688-45234710 AAGGCCGAGGGCGCTGGCGGGGG - Intronic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1167562291 19:50233055-50233077 AAGGCTCAGGACGCTGTCCCAGG + Intronic
929117127 2:38453812-38453834 AAGGCCAAGGATGCTGAGAGGGG + Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
932011342 2:67980609-67980631 AATCCCCAGGATGATGGCGGTGG - Intergenic
932087482 2:68774984-68775006 AAAACCCAGGCTGCAGTCGGTGG - Intronic
932709959 2:74055384-74055406 AAGGCCCAGCATGCTGTACATGG + Intronic
934623758 2:95832313-95832335 AAGCCCCAGGACACTGGCGGGGG + Intergenic
946206595 2:218113373-218113395 AAGGCCTGTGATGCTATCGGAGG + Intergenic
946337986 2:219050993-219051015 AAGGTCAAGGATGCTGGTGGTGG + Intergenic
946643613 2:221810385-221810407 AAGGCCCTGCATTCTTTCGGGGG - Intergenic
947298825 2:228665404-228665426 ATGCCCCAGGATGCTGTGGGTGG + Intergenic
947864680 2:233388086-233388108 CAGGCCCAGCACGCTGCCGGGGG - Intronic
1170733028 20:18990392-18990414 AAAGCCAAGGATGCTGGGGGAGG - Intergenic
1170892914 20:20391356-20391378 AGGGCCCAGGATACTCACGGGGG - Intronic
1171094328 20:22316887-22316909 AAGGCCCATGATGGGGTCTGGGG - Intergenic
1172744395 20:37195282-37195304 AAAGCCCAAGATGTTGACGGCGG - Intronic
1173628197 20:44489432-44489454 CTGGCCCAGGATGCTGTCACAGG - Exonic
1173986039 20:47262295-47262317 AAGATTCAGGATGCTGCCGGTGG + Exonic
1174907844 20:54571532-54571554 AAGGCCAAGGATGCTGCCAAAGG - Intronic
1175305463 20:57973021-57973043 AAAGCCCTGGAGGCTGTCGGGGG - Intergenic
1176008034 20:62876777-62876799 GAGGCCGAGGCAGCTGTCGGGGG - Intergenic
1179506193 21:41843397-41843419 AATGCCCAGGTTGCTGTCGAAGG - Intronic
1180700633 22:17779727-17779749 AGGGCCAAGGATGCTGTTGCAGG + Intergenic
1180841545 22:18961329-18961351 AAGGCCCAGGAGGGTGTCTCTGG - Intergenic
1180907801 22:19427373-19427395 AAGGTCCAGCCTGCTGCCGGAGG - Intronic
1184343201 22:43897478-43897500 AAGGCCCTGGATGCTGGAGCTGG + Intergenic
949952424 3:9240315-9240337 AGGGCCCAGGAAGCTGTCTTGGG - Intronic
951465954 3:23000717-23000739 AAGGGACAGGATGCTGTCCGCGG + Intergenic
953447829 3:42982776-42982798 AGGGCCCAGCGTGCTGTGGGAGG + Intronic
954218221 3:49136153-49136175 AAGGGCCAGGAGGCTGGAGGTGG - Intergenic
954538841 3:51380776-51380798 AGGTCCCAGGCTGCCGTCGGTGG - Intronic
961557623 3:127707355-127707377 ATGGCCAAGGACGCTGTGGGAGG - Intronic
961782343 3:129327759-129327781 AAAGCCCAGGAGGCTGTCCCGGG + Intergenic
962990431 3:140572869-140572891 AAGGCCCAGGATGGGGGCTGGGG - Exonic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966302230 3:178492634-178492656 AAAGCCCAGGAAACTGTGGGTGG + Intronic
966801969 3:183772512-183772534 AAGGCCCAGGTTACTGCCGCTGG + Exonic
967174743 3:186853049-186853071 AGGGCTCAGGATGCTGTTGCTGG + Exonic
969484601 4:7465137-7465159 AAGGCCCAGGATGCTCTGCTGGG + Intronic
970483371 4:16500219-16500241 TAGGCCCAGGAAGCTGACTGTGG + Intergenic
971823191 4:31586311-31586333 AAAGCCCAGGATGGGGCCGGGGG + Intergenic
972361501 4:38329667-38329689 AAGGCCCAGGATGCTCCTGTGGG + Intergenic
972709903 4:41584990-41585012 AAGGGCAAGGATGCTCTCTGGGG + Intronic
975986115 4:80202696-80202718 GAGGACCAGGACGCTGGCGGCGG + Exonic
976874492 4:89837039-89837061 AGCGCCCAGGACGCTCTCGGAGG + Intronic
980348289 4:131653291-131653313 AAGGCTCAGGAAGCTATCTGGGG - Intergenic
983686399 4:170414154-170414176 AAGATCCAGCATGCTGTGGGTGG + Intergenic
985933747 5:3079249-3079271 AAGACCCAGGAGGCTGCAGGCGG - Intergenic
986215721 5:5717119-5717141 AAGGCCCAGGAAGCAGCCTGGGG - Intergenic
986525425 5:8669070-8669092 AAGGCCCAGGATGCTAACCCTGG - Intergenic
996507348 5:124282723-124282745 ATGGCCCAGGATTCTGTAAGTGG + Intergenic
997479762 5:134176523-134176545 AAGGCCCAGGCTGCGGCCGGGGG - Intronic
1001565355 5:172696334-172696356 GAGGCCCAGGAGGTTGTAGGAGG - Intergenic
1002878725 6:1233865-1233887 AAGCCAGAGGAGGCTGTCGGGGG + Intergenic
1005637402 6:27765217-27765239 GCAGCCCAGGATGCTGTGGGTGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006387938 6:33742346-33742368 TAGGGCCAGGGTGCTGTCTGGGG + Intronic
1006920578 6:37624902-37624924 AAGGTGCAGGAGGCTGTAGGTGG - Intergenic
1007968201 6:46023431-46023453 AAAGCCCAGGATGTGGTTGGAGG + Intronic
1014557400 6:122851099-122851121 AAAGCCTAGGATGCTGCTGGTGG + Intergenic
1014983755 6:127977635-127977657 AATGCCCAGGAAGCTGTGGAAGG - Intronic
1017809918 6:157977310-157977332 AAGGCCCAGGACGCTGGCCACGG - Intergenic
1019321371 7:416961-416983 AAGGCCCTGGGTGGTGCCGGGGG + Intergenic
1019415604 7:925382-925404 AAGGCCCAGGATGGTGTGTAGGG + Intronic
1021243569 7:18234797-18234819 AAGGCCAAGGATTCTGTTGCAGG + Intronic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1023358996 7:39396792-39396814 TAGGCCCATGCTGCTGTCTGTGG + Intronic
1024056012 7:45660324-45660346 AAGGCTCAGGACGGTGTCAGTGG - Intronic
1026538191 7:71257878-71257900 AATGCCCAGGAGGCTGTGGTAGG - Intronic
1029339841 7:99933877-99933899 AACGTCCAGGATTCTGTTGGTGG + Intergenic
1029737239 7:102471776-102471798 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1029737260 7:102471837-102471859 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1033406303 7:141073777-141073799 AACGCCCCGGATGCGGCCGGCGG - Intergenic
1038976356 8:32700993-32701015 AAGGGCCAGCATGGTGTGGGAGG - Intronic
1041162891 8:55062819-55062841 AAGGGCCTGGATGCAGTCTGGGG + Intergenic
1042048553 8:64682482-64682504 AAGTCCCAGGAGACTGTCAGTGG - Intronic
1045798455 8:106074020-106074042 ATGGCCCATAATGCTGTCTGTGG - Intergenic
1047210585 8:122836904-122836926 AAGGCACAGGATGAGGTAGGAGG + Intronic
1048737272 8:137515573-137515595 AAGGCCCCAGATCCTGTCTGTGG + Intergenic
1049315895 8:141967302-141967324 AGTGCCCAGGATGCTGTCTGCGG - Intergenic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049384168 8:142332721-142332743 AATGCCCAAGATGCTGACTGAGG - Intronic
1049780785 8:144427936-144427958 CAGGCGCAGGAAGCTCTCGGTGG + Intronic
1052385852 9:27823030-27823052 AATGCCTTGGATGCTGTGGGAGG + Intergenic
1056576500 9:87859089-87859111 AAGGCCCAAGATGTTGCCGAGGG + Intergenic
1059416790 9:114167571-114167593 AAGGACCAGGTAGCTGTGGGTGG + Intronic
1060431900 9:123557601-123557623 AAGGCCCAGGCTGCTTTCTTCGG - Exonic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061906818 9:133703263-133703285 AGGGCCCAGGAGGCTGGAGGAGG + Intronic
1062284800 9:135768223-135768245 GAGGCCCAGGATGCCTGCGGGGG + Intronic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1192186025 X:68947327-68947349 AGAGCCCAGGAGGCTGTGGGAGG - Intergenic
1192579778 X:72271330-72271352 AAAGTCCAGGATGCTGCCAGGGG + Intronic
1200092058 X:153640599-153640621 AAAGCACAGGATGGTGGCGGAGG + Intergenic
1201561707 Y:15324125-15324147 AAAGCCCAGGATGCTGACAACGG - Intergenic