ID: 1062392123

View in Genome Browser
Species Human (GRCh38)
Location 9:136338057-136338079
Sequence CCTTCTGGGGAGGGGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1508
Summary {0: 1, 1: 1, 2: 13, 3: 175, 4: 1318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062392123_1062392141 8 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392141 9:136338088-136338110 GGTTCTAGGCTGCCCCGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 128
1062392123_1062392140 4 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392140 9:136338084-136338106 GTGGGGTTCTAGGCTGCCCCGGG 0: 1
1: 0
2: 2
3: 15
4: 162
1062392123_1062392143 16 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392143 9:136338096-136338118 GCTGCCCCGGGAAGGGCAGACGG 0: 1
1: 0
2: 4
3: 32
4: 336
1062392123_1062392147 29 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392147 9:136338109-136338131 GGGCAGACGGACAAAGCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 203
1062392123_1062392142 9 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392142 9:136338089-136338111 GTTCTAGGCTGCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1062392123_1062392139 3 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392139 9:136338083-136338105 GGTGGGGTTCTAGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 186
1062392123_1062392138 -6 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392138 9:136338074-136338096 AGAAGGCAAGGTGGGGTTCTAGG 0: 1
1: 0
2: 2
3: 25
4: 331
1062392123_1062392148 30 Left 1062392123 9:136338057-136338079 CCTCCCCTCCCCTCCCCAGAAGG 0: 1
1: 1
2: 13
3: 175
4: 1318
Right 1062392148 9:136338110-136338132 GGCAGACGGACAAAGCTCATGGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062392123 Original CRISPR CCTTCTGGGGAGGGGAGGGG AGG (reversed) Intronic
900142604 1:1144936-1144958 CCTCCTGGGGGTGGGAAGGGAGG - Intergenic
900183448 1:1322526-1322548 ACTTTTGAGCAGGGGAGGGGAGG + Intronic
900192836 1:1358688-1358710 CCTGCTGGGGAGGGGCAGTGTGG + Intronic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
900324924 1:2104053-2104075 TTTTCTGGGGAGAGCAGGGGAGG + Intronic
900335413 1:2160698-2160720 CCTTAGGGGGTGGGGAGGAGGGG + Intronic
900483981 1:2912800-2912822 CAGGCTGGGGAGGGGAGGGAAGG + Intergenic
900494937 1:2972033-2972055 CCTTCTCTGGCGGGGGGGGGGGG + Intergenic
900507539 1:3037206-3037228 CCTCCTGTGCTGGGGAGGGGTGG - Intergenic
900642150 1:3692828-3692850 CATTCCCGGGAGGGGTGGGGAGG + Intronic
900880803 1:5380025-5380047 CCTTCATGGGAAGGCAGGGGAGG - Intergenic
900919602 1:5662103-5662125 GCTTCTGGTGGGGTGAGGGGAGG - Intergenic
900941390 1:5800890-5800912 CCTTGTGGTGGGGGGTGGGGGGG - Intergenic
901013093 1:6211904-6211926 CCTACTGGGGAGGGGCAGTGGGG - Exonic
901054067 1:6440515-6440537 CCATCAGGGGTGGGGCGGGGGGG + Intronic
901217260 1:7561746-7561768 CCTGTTGGGCTGGGGAGGGGTGG - Intronic
901414489 1:9107191-9107213 CCTTCTGGAGAGGAGGTGGGTGG - Intronic
901634509 1:10664341-10664363 CCTTCTGCTCAGGGGAGGGTGGG - Intronic
901636618 1:10673508-10673530 CCTGCTGGGGAGGGGGGCTGAGG + Intronic
901693943 1:10992492-10992514 CTTCGTGGGGAGGGGAGGGGAGG + Intergenic
901775732 1:11559532-11559554 CGTTCTGGGGAGGGGGGGCAAGG - Intergenic
901875860 1:12166889-12166911 GCGTCTGGGGAGGGGCGTGGGGG + Intergenic
901931122 1:12596506-12596528 CCTGCTTCGGAAGGGAGGGGCGG - Intronic
902066544 1:13692856-13692878 ACTGCTGGGGAGGGGTGAGGTGG + Intergenic
902072468 1:13751965-13751987 GAATATGGGGAGGGGAGGGGAGG - Intronic
902192560 1:14773828-14773850 TTTTCTTTGGAGGGGAGGGGAGG - Intronic
902220038 1:14958832-14958854 CAGTGTGGGGAGGGGAGGGGAGG + Intronic
902394546 1:16125403-16125425 GCGGCTGGGGAGGGGAGTGGAGG + Intronic
902448805 1:16484152-16484174 CCCTCCGGGTAGGGGCGGGGCGG - Intergenic
902513254 1:16977258-16977280 GCTTCTGGAGAGTGGAGGCGGGG + Intronic
902696173 1:18142532-18142554 CCATCTGGGAAGGGGCAGGGAGG - Intronic
902706248 1:18207226-18207248 CCCTCTAGGGATGGGAGAGGAGG - Intronic
902985499 1:20152041-20152063 GCTTCTCGGGAGGGTGGGGGCGG - Intergenic
903462873 1:23531351-23531373 CTTTCCGGGGGGGGGGGGGGGGG - Intergenic
903471724 1:23592014-23592036 CCATCTGGAAAGGGGAGTGGAGG + Intronic
903499342 1:23792925-23792947 CCTTGGGGGTGGGGGAGGGGTGG + Intronic
903674457 1:25055375-25055397 ACTTCTGGGGAGGGCAGGACAGG - Intergenic
903793067 1:25907211-25907233 CCTTCTGCGGATGATAGGGGAGG + Intergenic
903820946 1:26102176-26102198 GCTTCTGTGGAGGGGAATGGCGG - Intergenic
903846061 1:26280501-26280523 CAGGGTGGGGAGGGGAGGGGAGG - Intronic
904598836 1:31662819-31662841 CCTCCTGGGGAGGCGACGTGTGG - Intronic
904614430 1:31742336-31742358 CCCACTGGAGTGGGGAGGGGAGG + Intronic
904629415 1:31829904-31829926 GCTGCTGGGGAAGGGTGGGGAGG + Intergenic
904787527 1:32993942-32993964 CCTTCTTGGGAGGACAGGTGAGG - Intergenic
904826570 1:33277067-33277089 CCGTCTGGGGTGGGGAGGCCCGG + Intronic
904829042 1:33295057-33295079 CCTTGTGGGGGTGGGTGGGGGGG - Intronic
904835895 1:33335893-33335915 CTATCTTGGGGGGGGAGGGGGGG + Intronic
905166007 1:36083961-36083983 CCTTTAGGGTAGGCGAGGGGCGG - Intergenic
905166227 1:36084676-36084698 CCGCCTGGGGACGGGAGGGAGGG + Intronic
905335216 1:37240257-37240279 CCCTCTGGGGAGGGGAGAGAGGG + Intergenic
905477714 1:38240597-38240619 CCTTCTTGGTGGGGGAGTGGAGG - Intergenic
905615612 1:39395707-39395729 CTTTGTGGGGTGGGGAGGTGGGG - Intronic
905658855 1:39704869-39704891 ACTTATGGGGAGGGGAGGTGGGG - Intronic
905819534 1:40979236-40979258 CCTTCGGGGCAGGTGTGGGGAGG + Intergenic
905869601 1:41395494-41395516 ACTCCTGGGGCTGGGAGGGGTGG - Intergenic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906078772 1:43070057-43070079 CCATCTGGGGAGTGGTGGGAGGG - Intergenic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906086073 1:43135722-43135744 CCTTCTGGTGAGGTAAGGTGAGG + Intergenic
906145485 1:43557983-43558005 CCTAGGAGGGAGGGGAGGGGTGG - Intronic
906152770 1:43597749-43597771 CCTTCTGGGGAGGGGCGGAGGGG - Exonic
906168952 1:43707755-43707777 CCGGCGGGGGAGGGGCGGGGCGG - Intronic
906210569 1:44010447-44010469 CCTTGTGGGCGGGGGGGGGGGGG + Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906662198 1:47590816-47590838 CCTGCTGGGCAGGGCAGGGTGGG + Intergenic
906675812 1:47693068-47693090 GATTCTGGAGATGGGAGGGGTGG + Intergenic
906865087 1:49409421-49409443 ACTTTTGGGGAGGGGAAGGAAGG + Intronic
907248597 1:53123284-53123306 CCTGCTGGTGCAGGGAGGGGAGG - Intronic
907406898 1:54259161-54259183 TCTTCTGGGGCGGGGTAGGGGGG - Intronic
907443140 1:54490576-54490598 CCAGGAGGGGAGGGGAGGGGAGG - Intergenic
908166396 1:61463347-61463369 CTTTCTGAGGAGGTGAGGTGTGG + Intergenic
908307694 1:62840150-62840172 CATTAATGGGAGGGGAGGGGAGG - Intronic
908477599 1:64505377-64505399 TCTGGAGGGGAGGGGAGGGGAGG + Intronic
909222283 1:72980622-72980644 TGTTCTGTGGAGGGGAGGAGTGG + Intergenic
909878628 1:80844693-80844715 CCTGCTGGGGGAGGGTGGGGAGG - Intergenic
910355089 1:86344167-86344189 GGTTGTGGGGAGGGGAGGGGAGG - Intergenic
910547202 1:88432236-88432258 ACTGCTGGGGGTGGGAGGGGTGG - Intergenic
910597191 1:88992773-88992795 TTTTTTTGGGAGGGGAGGGGCGG + Exonic
910881475 1:91925680-91925702 CTTGGAGGGGAGGGGAGGGGAGG + Intergenic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911045422 1:93623683-93623705 ACCTCTGGGAAGGGCAGGGGTGG - Intronic
911525003 1:98973886-98973908 ATTTCTGGGCAGGGGAGGGGTGG + Intronic
914096214 1:144546338-144546360 CCTTGGTGGGGGGGGAGGGGGGG + Intergenic
914412155 1:147440184-147440206 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
915334100 1:155130456-155130478 CCTTGGGAGGAGGGGAGAGGAGG + Intronic
915473232 1:156138018-156138040 TCTTCTGGGAAAGGGAGGGGAGG + Intronic
915589562 1:156862799-156862821 CCCTCTGGGCAGGGGCTGGGGGG + Intronic
915650600 1:157307650-157307672 AGCTCTGGGGAGGGCAGGGGAGG - Intergenic
916068675 1:161157027-161157049 CCCTCTTGGGAGGTGTGGGGTGG + Intronic
916226394 1:162493948-162493970 CCTGTTGGGGATGGGATGGGAGG + Intergenic
916296328 1:163224207-163224229 GAGGCTGGGGAGGGGAGGGGAGG - Intronic
916336084 1:163672677-163672699 TCTACTGGGGAGGGGAAAGGTGG - Intergenic
916508955 1:165454433-165454455 CCTCCTGTGGAGGGGAGAGGGGG - Intergenic
916577488 1:166080789-166080811 CCTCCTGTGGAGGGGTTGGGAGG - Intronic
916872139 1:168927233-168927255 TCTGTTGGGGTGGGGAGGGGTGG - Intergenic
917449181 1:175132721-175132743 CTTCCTGGGCAGGGGATGGGTGG - Intronic
917497088 1:175550330-175550352 CCTCCTGTGGAGGTGAGGGTTGG - Intronic
917976514 1:180243285-180243307 CTGTAAGGGGAGGGGAGGGGAGG + Intronic
918249472 1:182688889-182688911 CCTTCTGGAGGCTGGAGGGGAGG - Intergenic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918346293 1:183610176-183610198 TCTTCTGGGGGGTGGAGGGGAGG + Intergenic
919586651 1:199448025-199448047 CTTCCTGGGCAGGGGAAGGGCGG - Intergenic
919799824 1:201346947-201346969 CTTTCTGGGGGGGGCAGGGCTGG - Intergenic
920247891 1:204602154-204602176 GATTCAGGGGAGAGGAGGGGAGG - Intergenic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920360283 1:205410679-205410701 ACTCCTGGGCAGGGGTGGGGTGG + Intronic
920384618 1:205561689-205561711 CCTACAGGGGAGGGGAGGGGAGG + Intergenic
921177908 1:212609365-212609387 CCTTCCCGGGTGGGGGGGGGGGG + Intronic
921479957 1:215652710-215652732 CTTTCTGGGAAGTGGTGGGGGGG + Intronic
921736434 1:218633682-218633704 GCTCCTGGGGCGGGGAAGGGTGG - Intergenic
922044252 1:221928280-221928302 CCTTCTGCGGAGGAGAGGAGAGG + Intergenic
922204838 1:223437183-223437205 CCTCCTGGGAAGGGGTGGGTTGG - Intergenic
922377089 1:224979732-224979754 CCTTCTGTTGAGGAGAGGAGAGG + Intronic
922764360 1:228149677-228149699 GCGGCTGGGCAGGGGAGGGGAGG + Intergenic
922784247 1:228275295-228275317 CCTTCTGCGGAGTTGACGGGTGG + Intronic
923018052 1:230142149-230142171 CCTCCTGTGGAGGTGGGGGGAGG + Intronic
923030518 1:230245896-230245918 CCTTCTGGGTCTGGGTGGGGAGG + Intronic
923124038 1:231020126-231020148 CCTTGAGGGAAGGGGTGGGGAGG + Exonic
923457225 1:234174951-234174973 CCTCCTGGGGACAGGAAGGGAGG + Intronic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923650675 1:235870148-235870170 CCTTCTTGGGGGGTGTGGGGAGG + Intronic
924744548 1:246819364-246819386 TGTTGTAGGGAGGGGAGGGGAGG - Intergenic
924874674 1:248089412-248089434 ACTTCTGGGGAGGTGGGGGCTGG - Intronic
1062773706 10:126717-126739 CGTTGGGGGGGGGGGAGGGGCGG + Intergenic
1063101702 10:2955413-2955435 CCACATGGTGAGGGGAGGGGAGG + Intergenic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1063434155 10:6017271-6017293 GCTTCTGTGGACGGGAGGGTGGG + Intronic
1063811615 10:9715717-9715739 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
1063918633 10:10909720-10909742 CCTTTTGGGGAGGGCAGGAAGGG - Intergenic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065430765 10:25653110-25653132 CTTTCTAGGGAAGGGAAGGGAGG - Intergenic
1066361977 10:34740104-34740126 CCTCTTGGGGTGGGGACGGGAGG - Intronic
1066434491 10:35384614-35384636 CCTGCAGTGGAGGGGCGGGGTGG + Intronic
1067032744 10:42889274-42889296 ACTACTGGGGAGTGGAGGAGGGG + Intergenic
1067298615 10:44990472-44990494 GTTTCTGGGGAGGCGAAGGGTGG + Intronic
1067346298 10:45441325-45441347 GCAGCTGGGGAGGGGAGAGGAGG - Exonic
1067359641 10:45566765-45566787 CTTTCTGGCGGGGGGAGGGGGGG + Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1067832864 10:49620473-49620495 CCTGCCGGGGAGGGCAGGGAAGG - Exonic
1068071992 10:52207147-52207169 CCAGCAGGGGAGGGGAGGCGAGG + Intronic
1068325760 10:55484132-55484154 CCTTCTGAAGAGTGGAGGGTAGG + Intronic
1069403663 10:68075413-68075435 TCTTCCGGGGGGGGGGGGGGGGG + Intergenic
1069633787 10:69913318-69913340 CCTTCTGGGGAGACAAGAGGGGG + Intronic
1069680805 10:70283934-70283956 CCTGGTCGGGAGGCGAGGGGCGG - Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1069877555 10:71572431-71572453 CCTTCAGGGGAGCAGAGGTGGGG - Intronic
1070453095 10:76581485-76581507 CCAGCTGGGGAGGGTCGGGGAGG + Intergenic
1070570965 10:77638757-77638779 CCCAGTGGGGAGGGGAGGAGTGG + Intergenic
1071499183 10:86191499-86191521 GAGTCTGGGAAGGGGAGGGGTGG - Intronic
1071516707 10:86302425-86302447 CCTTGTGGGGAGGTGGGGAGAGG - Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071665205 10:87548325-87548347 TCTTCTTGGAGGGGGAGGGGAGG - Intronic
1072022509 10:91416856-91416878 AATTCTGGGGAGTGGTGGGGTGG - Intronic
1072183475 10:93011366-93011388 CCTACTGGGGAGGCTAGGGCAGG - Intronic
1072196248 10:93119281-93119303 CCTGCTGGGGTGGAGAAGGGCGG + Intergenic
1072268782 10:93755380-93755402 ACCATTGGGGAGGGGAGGGGAGG - Intergenic
1072314542 10:94189406-94189428 TCTTGTGGGGAGAGGAGGGAAGG - Intronic
1072551413 10:96480313-96480335 CCATCTGGGCAGGAGAAGGGAGG + Intronic
1072690207 10:97567827-97567849 TGGCCTGGGGAGGGGAGGGGAGG + Intronic
1072752078 10:97988253-97988275 TTTTTTGGGGTGGGGAGGGGTGG + Intronic
1073103749 10:101020675-101020697 TCTCCTGGGGAGGGGATGGTGGG + Exonic
1073454778 10:103629869-103629891 CCCCCTGGGGAGAGGAGGGGAGG + Intronic
1073593730 10:104780010-104780032 GCTTATGGGGAGGGGAAGGGAGG + Intronic
1073650672 10:105354654-105354676 CCATCCGGAGAGGGTAGGGGAGG + Intergenic
1074071849 10:110079381-110079403 CCTTCTGGGGAGTGGGGCTGAGG - Intronic
1074711741 10:116183622-116183644 CTTTCTGGAGAGGAGAGGGCTGG - Intronic
1075076827 10:119357522-119357544 GCTCCTGGGGAGTGGAGTGGGGG + Intronic
1075519442 10:123135275-123135297 CCTGCGGGAGGGGGGAGGGGCGG - Intergenic
1075659784 10:124185244-124185266 CCTGCTGGGATGGGGAGGGGAGG - Intergenic
1075663762 10:124216465-124216487 CATCCTGGGGAGGGGTGGCGGGG - Intergenic
1075683921 10:124350889-124350911 CCTGCCGGGGAGGGTAGGGATGG - Intergenic
1075689595 10:124386426-124386448 CCTTCAGGTGAGCAGAGGGGCGG - Intergenic
1075794185 10:125107146-125107168 CCTTCGGAGTAGGGGAGGAGGGG - Intronic
1075828208 10:125378875-125378897 CCTTCTTGAGAGTGGAGGGTGGG - Intergenic
1075869807 10:125762947-125762969 AGTTTGGGGGAGGGGAGGGGAGG - Intronic
1076423531 10:130351257-130351279 CCTTCTGGGGTGAGGACAGGTGG + Intergenic
1076443182 10:130494234-130494256 CTTTCTGGGGTGTAGAGGGGTGG + Intergenic
1076600115 10:131651896-131651918 CCTGCTGGCAAGGGGAGGGCAGG + Intergenic
1076635095 10:131876431-131876453 ACTCCCTGGGAGGGGAGGGGCGG + Intergenic
1077015386 11:396959-396981 CCTGGTGGGCATGGGAGGGGTGG - Exonic
1077097071 11:803584-803606 CCTCCTGGGAAGGGGGGAGGCGG + Exonic
1077108878 11:853435-853457 CCTACCTGGGAGGGGAAGGGAGG + Intronic
1077113669 11:873154-873176 ACTCCTGGGGAGGGAAGGTGGGG + Intronic
1077172639 11:1174771-1174793 CCGGCCGAGGAGGGGAGGGGAGG + Intronic
1077307766 11:1875668-1875690 CCTGCTGGGCATGGCAGGGGAGG - Intronic
1077409123 11:2395341-2395363 CCGCCTGGGGCGGGGCGGGGTGG + Intronic
1077439299 11:2560527-2560549 CCTTCTGGGGGGGCGGGGGGGGG + Intronic
1077485944 11:2838496-2838518 CCTGCTGGGCTGGGGAAGGGAGG + Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1078615832 11:12864816-12864838 CCTGCAGGGTAGGGGAAGGGAGG - Exonic
1079025623 11:16945677-16945699 CACTCTGTGGAGGTGAGGGGTGG + Intronic
1079074374 11:17374647-17374669 GGTTCTGGGGAGAGGAAGGGAGG - Exonic
1079075934 11:17385735-17385757 CCTAGCGGGGAGGGCAGGGGAGG - Intergenic
1079411395 11:20191171-20191193 CCTTCTGCAGAGGGGTGGCGGGG + Intergenic
1079489515 11:20972018-20972040 CCTGCTGGGGAGCGGGGTGGGGG + Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1079700502 11:23540350-23540372 TCTCCTGGGGCGGGGGGGGGCGG + Intergenic
1080017889 11:27526524-27526546 TTTTCTGGGGAGGGGAGGAGAGG + Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080397657 11:31904819-31904841 TATTCTGGGGTGGGGAGTGGAGG + Intronic
1080881616 11:36326686-36326708 CCTTGTGGGGATGGGGGTGGGGG - Intronic
1081050817 11:38338365-38338387 CCTGTTGGGGAGGGCAGGGTGGG + Intergenic
1081354927 11:42101049-42101071 CCTTTTGGAGAGTGGAGGGTAGG - Intergenic
1081551307 11:44115014-44115036 CCTTCTGGGATGGGGTGGAGGGG + Intronic
1081651940 11:44830034-44830056 CCTTGTGAGGAGGGCAGGGGTGG - Intronic
1081864566 11:46352482-46352504 GCCTCAGGGGACGGGAGGGGTGG - Intronic
1082216912 11:49582548-49582570 CCTTCTGGAAAGGGAAGAGGAGG - Intergenic
1082802467 11:57425085-57425107 GCTGTTGGGGCGGGGAGGGGGGG + Intronic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1082964132 11:58948151-58948173 CCTTCTGGGAAAGGGGGTGGAGG + Intronic
1082986445 11:59173772-59173794 CCTTGGGGGGTGGGGAGTGGGGG + Intronic
1083015762 11:59452273-59452295 CCTTTTGGAGAGTGGAGGGTGGG - Intergenic
1083048368 11:59755785-59755807 CCCGCAGGGGAGGGGAGGGGAGG - Intronic
1083278560 11:61611359-61611381 CTGCCTGGGGTGGGGAGGGGAGG - Intergenic
1083590044 11:63888478-63888500 ACTTCCGGGGAGGGGGGGAGGGG + Intronic
1083722273 11:64609250-64609272 GGTTCTGGGGAGGGGGAGGGGGG - Intronic
1083815976 11:65132701-65132723 GATTCAGGGGAGGGGAAGGGAGG - Intronic
1083839669 11:65297101-65297123 CATCCTGGGGAGGAGAGGAGAGG - Exonic
1083923671 11:65793519-65793541 CCTGCTGGGGTGGGGGTGGGAGG + Intronic
1083990375 11:66242842-66242864 TCGGCTGGGGAGGAGAGGGGTGG + Intronic
1084153519 11:67302097-67302119 CCTTCCAGGCAGGGCAGGGGAGG - Exonic
1084312921 11:68327078-68327100 CCTGCTGGGGCGGGCAGGGACGG - Intronic
1084332090 11:68436450-68436472 GCTTGAGGGGAGGGGAGGGGAGG - Intronic
1084559709 11:69896257-69896279 ACTGGTGGGGTGGGGAGGGGTGG - Intergenic
1084595271 11:70113120-70113142 CCGCCTGGGGTGGGGTGGGGCGG - Intronic
1084600465 11:70142527-70142549 TCTCCTGGGGAGTGGCGGGGCGG - Intronic
1084605860 11:70171228-70171250 GCATCTTGGGAGGGGAAGGGTGG - Intronic
1084648546 11:70474664-70474686 GCCACTGGGGAGGGGAGGAGAGG + Intronic
1084653592 11:70502737-70502759 CCTACTGGGGGGGGGGGGTGGGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084740166 11:71134253-71134275 GCATCTGGGGAGGGGAGAGGGGG + Intronic
1084854886 11:71976948-71976970 GCTTGTGGGGAGGGAAAGGGAGG - Intronic
1084859777 11:72010851-72010873 CCACCTGGGGAGGGAAGAGGAGG + Exonic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085390784 11:76181033-76181055 CCTCCGGGGGAGGGGACGTGGGG + Intergenic
1085455189 11:76661505-76661527 CCACCTGGGGAGGGGTAGGGTGG + Exonic
1085532994 11:77202731-77202753 GCTTCTGGGGCGGGGGGTGGGGG + Intronic
1086162033 11:83732803-83732825 CCAACTGGGGAGGGGAATGGGGG + Intronic
1086376538 11:86206604-86206626 TCTGCTGGGGAGGGGAGAGGGGG + Intergenic
1086840009 11:91673401-91673423 GCTTCAGGGGAGGAGTGGGGAGG - Intergenic
1087901500 11:103646457-103646479 CTTTCTGTGGGGGGGGGGGGGGG + Intergenic
1087944497 11:104141807-104141829 CCTTCTGGAGGGCGTAGGGGAGG - Intronic
1088058036 11:105609820-105609842 CATCCTGGGAAGGGGAGGAGGGG - Intergenic
1088364896 11:109030461-109030483 CCTTTTGTGGAGTGGGGGGGAGG - Intergenic
1088578724 11:111297334-111297356 CCTTCTGTGGAGGGGGCGGGTGG + Intergenic
1088719092 11:112576259-112576281 CCTTCAGATGAGGGCAGGGGAGG - Intergenic
1088728327 11:112658790-112658812 AAATCTGGGGAGGGGAGGGGAGG - Intergenic
1089048558 11:115525985-115526007 AATTCTGGGGTGGGGAGGTGGGG - Intergenic
1089125642 11:116174669-116174691 TGGTCAGGGGAGGGGAGGGGAGG - Intergenic
1089189633 11:116644499-116644521 CCATCCGGGGAGGGGCGGGTGGG + Intergenic
1089227496 11:116938201-116938223 TCTAGAGGGGAGGGGAGGGGAGG + Intronic
1089393376 11:118117261-118117283 ACTGCTGGGGAGGGCAGGTGAGG - Intronic
1089399403 11:118155816-118155838 CCCTTGGGGGAGGGCAGGGGTGG + Intergenic
1089400316 11:118160641-118160663 CAAGCTGGGGAGGGAAGGGGAGG + Intergenic
1089447513 11:118565453-118565475 ACCTCTGGGGTGGGGTGGGGTGG + Intronic
1090426200 11:126608544-126608566 CCATTTGGGGAGGGGAGAGGAGG - Intronic
1090692000 11:129193303-129193325 CTTTATGGGGGGGGGGGGGGGGG + Intronic
1091225737 11:133955892-133955914 GCGGCGGGGGAGGGGAGGGGCGG - Intronic
1091428031 12:408530-408552 GCTTTTGGAGAGGGGAGTGGGGG + Intronic
1091725959 12:2846478-2846500 CCTCCTGGCGAGAGGACGGGAGG - Intronic
1091741179 12:2961065-2961087 CCTTTGGGGGATGGGATGGGCGG + Intronic
1091807044 12:3364337-3364359 CCAGCTGAGGAGGGGAGGGGAGG - Intergenic
1092135391 12:6143528-6143550 CCAGCTGGGGGGGGGGGGGGGGG - Intergenic
1092258927 12:6942081-6942103 CCAACGGGGCAGGGGAGGGGCGG - Exonic
1092285315 12:7125255-7125277 CCTTTAGGGGAGAGCAGGGGTGG + Intronic
1092491470 12:8949537-8949559 CCTTCTGGGGATGGGAGACGGGG + Exonic
1092570837 12:9719625-9719647 CCTTCTGGAGGCTGGAGGGGTGG + Intronic
1093215887 12:16360981-16361003 CTTTTGGGGGCGGGGAGGGGGGG - Intronic
1093498616 12:19784353-19784375 CCTTCACGGGAGAGGCGGGGAGG - Intergenic
1094556802 12:31508941-31508963 CCTTTGGGGGAGGGGCGAGGTGG + Intronic
1094709946 12:32952001-32952023 CTTTCTGCTGAGGGGAGGGAAGG - Intergenic
1094762179 12:33546688-33546710 ACTACTGGGGTGGGGAGGGAAGG + Intergenic
1094798231 12:34000846-34000868 GCTTCTGGGTAGGGTAGGTGTGG + Intergenic
1095721616 12:45407483-45407505 CATTCCGGGGGGGGGGGGGGGGG - Intronic
1096148415 12:49294535-49294557 TCTTCAGGGGAGGGGGAGGGGGG + Exonic
1096149168 12:49297864-49297886 CCCTGAGGGCAGGGGAGGGGCGG - Intronic
1096214797 12:49792983-49793005 CAGGCTGGGGAGGGGAGGGGAGG + Exonic
1096334859 12:50746557-50746579 CCCTCTGTGGAGGAGTGGGGAGG - Exonic
1096387854 12:51206763-51206785 TCTTCTGGGGTGGGAAGTGGGGG - Intronic
1096441569 12:51648048-51648070 GCCTCTGGGGAGGAGAAGGGTGG + Intronic
1096517265 12:52163895-52163917 CCTGCTGGGGAAGGGAGGCCAGG + Intergenic
1096529150 12:52232605-52232627 CCTACTGGAGTGGGGAGGGGAGG + Intronic
1096628006 12:52907084-52907106 GGGCCTGGGGAGGGGAGGGGAGG - Intronic
1096674212 12:53217738-53217760 CCTGCTGGGGAGGATGGGGGTGG + Intronic
1096780957 12:53991863-53991885 CCCACTGGGGAGGGTAGGAGTGG - Intronic
1096782819 12:54000755-54000777 CCGGCGCGGGAGGGGAGGGGAGG + Intronic
1096804739 12:54133782-54133804 CTCTCTGGGTAGGGGAGAGGCGG - Intergenic
1096889193 12:54749584-54749606 CTTTCTGGGGAGGGTGGGTGTGG + Intergenic
1097179814 12:57165335-57165357 CGTTCTGGGGACAGGATGGGTGG + Intronic
1097679221 12:62633191-62633213 TTTTCTGGGGAGGAGAGGGGAGG - Intergenic
1098002886 12:65963396-65963418 TCATCTGGGGTGGGGTGGGGTGG + Exonic
1098005537 12:65993272-65993294 CCTTGTGGGGAGGGAGTGGGAGG - Intergenic
1098161000 12:67648545-67648567 TTTTCCGGGGAGCGGAGGGGCGG + Intronic
1100225533 12:92552225-92552247 CATTCTGGAGGGGGCAGGGGAGG - Intergenic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1100555484 12:95689072-95689094 GCTTATGGGGAGGGGCGTGGGGG - Intronic
1101592822 12:106138997-106139019 CCTCCCGGGGAGGGGTTGGGGGG - Exonic
1101632164 12:106505673-106505695 CACTCTGGGGAGGGCAGGTGAGG - Intronic
1101970632 12:109309784-109309806 CCTGCTGGGGCCGCGAGGGGGGG + Intergenic
1102025487 12:109712211-109712233 CAGCCTGGGGAGGGAAGGGGAGG + Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102254929 12:111409892-111409914 CCGGCTGGGGCGGGGAGTGGGGG - Intronic
1102505428 12:113381512-113381534 CCCTGCGGGGACGGGAGGGGTGG + Intronic
1102505964 12:113384829-113384851 CCTGCCGGGCAGGGGAAGGGAGG - Exonic
1102507866 12:113395241-113395263 GCTCCTGGGGAAGGGAGAGGGGG - Intronic
1102537550 12:113592475-113592497 GCTGCTGGGGAGGGCAGGTGAGG + Intergenic
1102955900 12:117058902-117058924 CCTTCTGTGAAAGGCAGGGGAGG - Intronic
1103083468 12:118043454-118043476 ACTTTTGGGGAGTGGAGGGAAGG + Intronic
1103360908 12:120353115-120353137 GCTTCTGGGGAGGGGTTTGGGGG + Intronic
1103667612 12:122582457-122582479 CTTGCTGAGGTGGGGAGGGGAGG + Intronic
1103896135 12:124274478-124274500 CCTTCTGGGGGAGGGGAGGGCGG + Intronic
1103903574 12:124315850-124315872 CCCTCTGTGGAGGTGAGGAGGGG + Exonic
1104075867 12:125389332-125389354 AGTTGAGGGGAGGGGAGGGGAGG - Intronic
1104278886 12:127355520-127355542 CCTTCTGGTGAGGGAAGGCATGG + Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104485559 12:129148824-129148846 CCTCTTGGGGAGGGTGGGGGCGG - Intronic
1104749485 12:131229404-131229426 ACTGCTGGGGTGGGGTGGGGAGG + Intergenic
1104850092 12:131868636-131868658 CCTTCTGAGGTGGGGGCGGGGGG - Intergenic
1104897943 12:132173417-132173439 TCTGTTGGGGAGGGGAGGGGAGG + Intergenic
1104933281 12:132351667-132351689 CCCTCTGGGGACAGGAGGGATGG + Intergenic
1105215306 13:18280681-18280703 GCTGCGGGGGTGGGGAGGGGGGG + Intergenic
1106181259 13:27371663-27371685 CCTTCTTGGGTGGGGAGGACTGG - Intergenic
1106269508 13:28139187-28139209 CCGCCTTGGGAGGTGAGGGGGGG - Intronic
1106701715 13:32235795-32235817 CCCTCTGCTGAGGGGAGGGTGGG - Intronic
1106718546 13:32416819-32416841 CCGTCTGGAGGGGGGTGGGGCGG - Intronic
1106994698 13:35468114-35468136 TTTTCAGGGGAGGGGAGTGGGGG - Intronic
1107011737 13:35677135-35677157 CCTACTGGACAGTGGAGGGGAGG - Intergenic
1107314249 13:39114145-39114167 CTATTGGGGGAGGGGAGGGGAGG - Intergenic
1107386277 13:39913361-39913383 CCTTCTGAGGAATGGAAGGGAGG + Intergenic
1108316752 13:49244132-49244154 CTTGAAGGGGAGGGGAGGGGAGG - Intergenic
1108572821 13:51767771-51767793 TCTCCTGGGGCGGGGGGGGGGGG + Intergenic
1108682378 13:52790927-52790949 CACAGTGGGGAGGGGAGGGGAGG - Intergenic
1108710369 13:53027277-53027299 GCTTCTGGGGTGGGGTGGAGTGG + Intergenic
1109004355 13:56852439-56852461 CTTTCTGGGGAGGGCAGAGCAGG + Intergenic
1109271044 13:60255284-60255306 ACTGGAGGGGAGGGGAGGGGAGG - Intergenic
1110009717 13:70316917-70316939 CCTTATGGAAAGGGGAGGTGGGG - Intergenic
1111677894 13:91409859-91409881 ACTTCTAGAGAGGGGAGGGAGGG - Intronic
1112247462 13:97747737-97747759 GCCTCCGGGGAGGTGAGGGGAGG + Intergenic
1112439979 13:99418196-99418218 CCTTCTGGGGGTGGCAGGAGGGG - Intergenic
1112811797 13:103226597-103226619 CCTGCTGGGCTGGGGAGGGATGG + Intergenic
1112883029 13:104133044-104133066 CATTCTGGGGAGTGGCTGGGAGG + Intergenic
1113433245 13:110268352-110268374 ATTTCTTGGGTGGGGAGGGGAGG + Intronic
1113855960 13:113445599-113445621 ACCTTTGGGGAGGGGAGGGGTGG + Intronic
1113982633 13:114289032-114289054 CCTGCCGGGGTGGGGAGAGGGGG + Intronic
1114360333 14:21965253-21965275 GCTCCTGCGGTGGGGAGGGGAGG + Intergenic
1114392057 14:22320278-22320300 AATTCTGGGGAGGGGAGAGAAGG + Intergenic
1114530524 14:23392752-23392774 CTTTCTGGGCTGGCGAGGGGAGG - Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114873059 14:26681287-26681309 CCTTTTGGAGAGTGGAGGGTGGG - Intergenic
1115180679 14:30622294-30622316 CCGGCTGGGGAGCGGAGCGGGGG - Exonic
1115440719 14:33432141-33432163 CCTTCTGCCCAGTGGAGGGGTGG - Intronic
1115486106 14:33912930-33912952 GCTGGTGGGGAGGGGAGAGGAGG - Intergenic
1115849251 14:37575854-37575876 GCTTCTGGTGGGGGAAGGGGAGG - Intergenic
1115957387 14:38796575-38796597 CCTTCTGGGGTTGGGTGGGGTGG - Intergenic
1116942836 14:50808233-50808255 CATCCTGGGGGAGGGAGGGGCGG + Intronic
1117066977 14:52021001-52021023 TCTGCTGGGGATGGGAGGGGTGG - Intronic
1117074500 14:52088819-52088841 CTCTCTGGGTAGGGAAGGGGAGG - Intergenic
1117289589 14:54319731-54319753 TTTTATGGGGAGTGGAGGGGAGG - Intergenic
1117803296 14:59465655-59465677 CCTTTTGGGGAGTGGTGGGGGGG + Intronic
1117866102 14:60150952-60150974 CCTTTTGGAGTGGGGAGAGGAGG - Intronic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1118366756 14:65102720-65102742 CGTCCCGGGGAGGGGGGGGGGGG + Intergenic
1118614692 14:67567229-67567251 CCATCTGGGGAGGGCGGTGGGGG + Intronic
1118777143 14:68979877-68979899 CCTTGTAGGGTGGGGTGGGGTGG - Intergenic
1118921860 14:70156744-70156766 CCAGCAGGGGAGGGGTGGGGAGG + Intronic
1119149226 14:72342980-72343002 CCTTCTGGGGAAGCAGGGGGTGG - Intronic
1119242692 14:73074569-73074591 TCTTGTGGGGAGGTGGGGGGTGG + Intronic
1119383961 14:74245732-74245754 CATCATGGGGAGGGGAGGAGAGG - Intronic
1119404694 14:74390332-74390354 GCTTCGGGAGAGGGGAGGGGTGG - Intergenic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1119562471 14:75602229-75602251 CACTCCAGGGAGGGGAGGGGAGG - Intronic
1119611210 14:76064009-76064031 CATTCCGGGCAGGGGATGGGGGG + Intronic
1120363909 14:83541363-83541385 CCTTGTGGGTGGGGGAGGAGTGG + Intergenic
1121075094 14:91060942-91060964 CGTTCTGGGGAGGTCAGGGAAGG - Intronic
1121246655 14:92465620-92465642 CCTCGTGGGGAGGGAAGGAGCGG - Intronic
1121329422 14:93040672-93040694 CCTCCTGCGGGGGGGAGAGGGGG - Intronic
1121622960 14:95362970-95362992 TTTTCTGGGGAGGAGAGAGGAGG - Intergenic
1121692662 14:95889137-95889159 ACAGCAGGGGAGGGGAGGGGAGG - Intergenic
1122100503 14:99405584-99405606 CCGTGTGGAGAGGAGAGGGGAGG + Intronic
1122216128 14:100205801-100205823 CCTTCTGGAGAGGTGAGCTGGGG + Intergenic
1122439321 14:101719164-101719186 CTGTGAGGGGAGGGGAGGGGAGG + Intergenic
1122534358 14:102451910-102451932 CCTTCTGGGGATGGGGCCGGGGG - Intronic
1122651688 14:103230069-103230091 TCCTATGGGGAGGGGAGGAGGGG + Intergenic
1122754763 14:103969809-103969831 GGTTCTGGGGTGGGGCGGGGTGG + Intronic
1122771025 14:104097714-104097736 GCGTCTGGGGAGGGGCTGGGGGG - Intronic
1122789858 14:104179590-104179612 TCAACTGGGGAGGGGAGGAGAGG - Exonic
1122808849 14:104277743-104277765 CCTTTTGGAGAGGGAAAGGGCGG - Intergenic
1122888780 14:104723326-104723348 TCTACTTGGGAGGGGTGGGGCGG + Intergenic
1122947141 14:105017161-105017183 GCTCCTGGGGAGGTGGGGGGCGG + Intronic
1122961929 14:105097877-105097899 GCTTATGGGGAGGGCAGAGGGGG + Intergenic
1122980849 14:105191802-105191824 CCTTCCGGAGAGTGCAGGGGCGG + Intergenic
1202906014 14_GL000194v1_random:72883-72905 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1124368372 15:29089647-29089669 CCCTCTGGAGAGGGAAGGGGAGG - Intronic
1124383944 15:29190574-29190596 CCTTCCAGGTATGGGAGGGGAGG + Intronic
1124594416 15:31081300-31081322 CTTTCTCAGGGGGGGAGGGGGGG + Intronic
1124634315 15:31355237-31355259 CCTTCTGCTCAGGGGAGGTGAGG - Intronic
1124637964 15:31376955-31376977 CATTCCGGGGAGGGGGGTGGGGG + Exonic
1125031307 15:35078789-35078811 AATTATGGGGAGGGTAGGGGAGG - Intergenic
1125200339 15:37096806-37096828 CCTTCTTGGGAGGTCAGGGCTGG - Intronic
1125483060 15:40093576-40093598 GCAGCTGGGGAGGGGAGGAGAGG - Intronic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125597332 15:40895200-40895222 CCTTCTGGAGGTGGGAGGGAAGG + Intronic
1125786410 15:42322390-42322412 CTTTCTGGGGAGAGCAGGGGTGG + Intronic
1127184672 15:56465594-56465616 GCTTCTGCGGGGGGGGGGGGGGG - Intergenic
1127258098 15:57308029-57308051 ACTACTGGGGAAGGCAGGGGTGG - Intergenic
1127535339 15:59885087-59885109 CATTCTTGGGTGGGGTGGGGTGG - Intergenic
1128226280 15:66003624-66003646 CATTCTGGGGTGGGCAGAGGTGG - Intronic
1128411916 15:67408000-67408022 CCATCTGGGGACTGGAGGAGAGG + Intronic
1128447789 15:67779981-67780003 CTTCCAGGGGAGGGGAGAGGAGG - Intronic
1128552724 15:68608733-68608755 GAGTCTGGGCAGGGGAGGGGTGG - Intronic
1129082391 15:73052414-73052436 CATTCCGGGGCGGGGGGGGGGGG - Intronic
1129175219 15:73835244-73835266 CCTACTGGGGAAGGAAGGAGGGG + Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129379125 15:75154477-75154499 TCTGCCGGGGAGGGGAGGGGTGG - Intergenic
1129424517 15:75454343-75454365 CCTGCAGGGGAGCTGAGGGGCGG - Intronic
1129607405 15:77031555-77031577 TCTGCCGGGGATGGGAGGGGAGG + Intronic
1129707096 15:77800506-77800528 GCTCTGGGGGAGGGGAGGGGTGG - Intronic
1129709603 15:77813885-77813907 CCTTCTGGGGCAGGGTGGGGAGG - Intronic
1130407464 15:83614525-83614547 CCTTAGGGGAAGGAGAGGGGAGG + Intronic
1130650623 15:85760256-85760278 GGCTCTGAGGAGGGGAGGGGAGG + Exonic
1131026876 15:89150525-89150547 TTTTCGGGGGAGGGGAGGAGGGG - Intronic
1131035942 15:89222026-89222048 CCTGCTGGCTGGGGGAGGGGTGG - Intergenic
1131065034 15:89429279-89429301 CCTCCTGGGGAGAGGAGTGGAGG - Intergenic
1131257582 15:90872099-90872121 CCGCCCGGGGAGGGGAGGAGCGG + Intronic
1131373465 15:91903924-91903946 GCTTGTGGAGAGGGCAGGGGTGG + Intronic
1131536258 15:93240285-93240307 CCTTCTGGGCTGGAGAGGAGAGG + Intergenic
1132108609 15:99085504-99085526 CCCTCTGGGGAGGAGAGGAAGGG - Intergenic
1132115881 15:99136224-99136246 CTTCCTGGGGTGGGGTGGGGTGG + Intergenic
1132153072 15:99475944-99475966 CTATCTGGGGTGGGGAGGGAGGG - Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132362389 15:101227370-101227392 CCTTCTTGGAAGGGGATAGGGGG + Intronic
1132426830 15:101724598-101724620 CCTGCAGGGGCGGGGCGGGGCGG + Exonic
1132426850 15:101724643-101724665 CCTGCAGGGGCGGGGCGGGGCGG + Intergenic
1132498586 16:275079-275101 GCCTCTGGGGAGGGGTGGGACGG + Exonic
1132555241 16:569358-569380 CCCTGTGGGGTGGGGAGGTGGGG + Exonic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1132708860 16:1257835-1257857 CCATCTGGGGAAGGGAGGGGAGG - Intronic
1132732036 16:1367429-1367451 GATGCTGGGGAGGGGAGGGGAGG - Intronic
1132840853 16:1977937-1977959 GCCTGTGGGGAGGGGAGGAGAGG - Exonic
1132906076 16:2283425-2283447 CAGCCTGGGGAGGGGAGTGGGGG - Intronic
1133034405 16:3026992-3027014 ACTCCTGGGATGGGGAGGGGAGG - Exonic
1133060693 16:3172479-3172501 GTTTCTAGGGCGGGGAGGGGAGG - Intergenic
1133154309 16:3861981-3862003 TCTCCTGGGGAGGAGAGGGTGGG - Intronic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133650191 16:7805504-7805526 CCTTCAGGGGGGCGGGGGGGTGG + Intergenic
1133965730 16:10530434-10530456 CCTTCTGCTGAGTGGAGTGGTGG - Exonic
1134232652 16:12440592-12440614 CCTTCTGGTGGGTGGAGGGTGGG - Intronic
1134441742 16:14302773-14302795 CCCTCTGGGGAGCGGGGGAGGGG - Intergenic
1135047837 16:19168902-19168924 CCTCTTGGGGAGGGAATGGGGGG + Intronic
1136027045 16:27475175-27475197 CCTTCGGGATTGGGGAGGGGTGG + Intronic
1136277324 16:29186704-29186726 CTTTCTGGGAAGGCGAGGGTCGG + Intergenic
1136349061 16:29695251-29695273 GGCTCTGGAGAGGGGAGGGGAGG - Intronic
1136413719 16:30091403-30091425 CCTCCCGGGGTGGGGAGGGAGGG - Intronic
1136618054 16:31410634-31410656 GGTTCTGGGGAGGGGAGATGGGG + Intronic
1137344354 16:47641119-47641141 TTTTGTGGGGAGGGGAGGGGAGG + Intronic
1137476739 16:48815881-48815903 CCTATTGGGGAGTGGAGGGTGGG + Intergenic
1137499577 16:49000112-49000134 CCTGCTGCGGAGGGTGGGGGGGG + Intergenic
1137574853 16:49592790-49592812 GCATGTGGGGAGGGGAGGCGAGG - Intronic
1137616244 16:49848956-49848978 CTTTCTGGGGAAGGCAGGGAGGG + Intronic
1137685178 16:50381817-50381839 CCTCCTGGGATGGGGAGGGTGGG + Intergenic
1138083830 16:54115962-54115984 TCTGCTGGGGTGTGGAGGGGAGG - Exonic
1138291278 16:55849282-55849304 ATTTCTGGGAAGGGGAGGGAGGG + Intronic
1138506267 16:57479831-57479853 CGTCCTGGGGTGGGGAGGGAAGG - Intronic
1138523875 16:57590549-57590571 GCCTCTGGGGAGGGGAGGTAGGG + Intronic
1138822048 16:60272575-60272597 CGATCTCGAGAGGGGAGGGGAGG - Intergenic
1138920011 16:61515842-61515864 CCTTGGGGGTCGGGGAGGGGAGG + Intergenic
1139471074 16:67178504-67178526 CCTGCGGGGAAGGCGAGGGGAGG + Exonic
1139505565 16:67396557-67396579 CCTGCTGGGGTGGGGGTGGGTGG + Intronic
1139699344 16:68698086-68698108 CCTTTAGGGGAGGGGAGAGAGGG + Intronic
1139995669 16:70978123-70978145 TCTTGGTGGGAGGGGAGGGGAGG - Intronic
1140281015 16:73555486-73555508 CCCACTGGGGAGGGAAGCGGAGG - Intergenic
1140396719 16:74633584-74633606 ACTGCTGGGGATGGGAGAGGAGG + Intronic
1140457292 16:75112797-75112819 GCTGCTGGGGAGAGGTGGGGAGG - Intronic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1140776563 16:78254410-78254432 TTTTCTGGGGTGGGGTGGGGTGG - Intronic
1141683487 16:85557020-85557042 CCTGGAGGGGAGGGGAGGGGAGG + Intergenic
1141690368 16:85593286-85593308 TCTGCTGTGGAGGGGAGGGGCGG - Intergenic
1141694755 16:85614084-85614106 TCTTCTGCGGGGGGGAGGGGAGG - Intronic
1141842336 16:86581065-86581087 CAGTCTGGGGAGGGGAGAAGAGG + Exonic
1141962089 16:87415796-87415818 CGTCCTGGGGAGGGTGGGGGTGG - Intronic
1141972793 16:87494242-87494264 GCGACTGGGGCGGGGAGGGGGGG - Intergenic
1141984812 16:87572827-87572849 CTTCCTGGGGAGGGGAGTGTGGG - Intergenic
1142066005 16:88063273-88063295 CACACCGGGGAGGGGAGGGGAGG - Intronic
1142081702 16:88152748-88152770 CTTTCTGGGAAGGCGAGGGTCGG + Intergenic
1142144941 16:88489054-88489076 CCTCCTGGGGATGTGGGGGGCGG - Exonic
1142214274 16:88823138-88823160 TCTGCTGGGGAAGGGAGGGGAGG + Intronic
1142256764 16:89017597-89017619 CCTTCGGGGGAGGGTAAGTGAGG + Intergenic
1142313224 16:89326380-89326402 CCTTCTGCAGCGGGGTGGGGGGG - Intronic
1142323768 16:89401096-89401118 CCCTCTGGGGAGGGGGAGGGCGG - Intronic
1142352480 16:89586546-89586568 CGTGGTGGGGAGGGGAGGGGAGG - Intronic
1142586643 17:978842-978864 CACAGTGGGGAGGGGAGGGGAGG - Intronic
1142591583 17:1008528-1008550 CCTTGTGGGGAGGAGTGGGAAGG - Intronic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142697975 17:1643967-1643989 CCTGCGGGGGTGGGGACGGGAGG + Exonic
1142752701 17:1998200-1998222 CCTTTGGGGGAGGGGCGGGGAGG + Intronic
1142981897 17:3677254-3677276 GCCTCTGAGGAGGGGTGGGGAGG + Intronic
1143134545 17:4704170-4704192 CCTACTGGGGAGGGGGCGTGGGG + Exonic
1143329774 17:6124984-6125006 CCTTCTAGGGAGGGTAGGTGTGG + Intergenic
1143332740 17:6149445-6149467 CCTTCTGGGAGGCTGAGGGGAGG - Intergenic
1143374298 17:6458256-6458278 TATCCTGGGGAGGGGAGGGAAGG - Intronic
1143411495 17:6712256-6712278 CTGCCTGGGGAGGGGAGGTGGGG + Intronic
1143497893 17:7322863-7322885 ACCTCTGGGGAGGAGAGGGAAGG + Exonic
1143527984 17:7483389-7483411 CCGTGAGGGGAGGGGTGGGGAGG - Exonic
1143713094 17:8746875-8746897 TCCTCAGGAGAGGGGAGGGGAGG - Intergenic
1143868189 17:9939298-9939320 CCTTCTGTGGCTGGGAGGGTTGG + Intronic
1144124067 17:12184328-12184350 GCCTCTGGGGAGGGAAGTGGGGG - Intergenic
1144187559 17:12810550-12810572 ACTTCTGGGGAGGGGAGAAGTGG + Intronic
1144301596 17:13926558-13926580 GGTTCTGGGGAGGGGAAAGGAGG - Intergenic
1144855189 17:18263691-18263713 CCTTCTGCAGAGTGAAGGGGCGG - Exonic
1144963730 17:19062385-19062407 CCGTCTGGGGGTGGGAGTGGCGG - Intergenic
1144963950 17:19063642-19063664 CCGTCTGGGGGTGGGAGTGGCGG + Intergenic
1144971429 17:19112142-19112164 CCGTCTGGGGGTGGGAGTGGCGG + Intergenic
1144984002 17:19188487-19188509 CCGTCTGGGGGTGGGAGTGGCGG - Intergenic
1144984223 17:19189752-19189774 CCGTCTGGGGGTGGGAGTGGCGG + Intergenic
1145018646 17:19414176-19414198 CCTAGTGGGGAGGGTGGGGGTGG - Intronic
1145057958 17:19715414-19715436 CCTTCTGGGTAGGGACGTGGAGG - Intronic
1145101937 17:20084860-20084882 CCATCTGGGCAAGGGAGGTGGGG + Intronic
1145260719 17:21352779-21352801 CCTGGCGGGGAGGGGAGAGGCGG + Intergenic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1146004265 17:29150944-29150966 TCATCTGGGGAGGAGAGAGGAGG + Intronic
1146004648 17:29153686-29153708 TCATCTGGGGAGGAGAGAGGAGG - Intronic
1146014559 17:29222355-29222377 CCCTCTGGGGATGGGAGATGTGG + Intergenic
1146123717 17:30216245-30216267 TGTTCCAGGGAGGGGAGGGGAGG + Intronic
1146341124 17:32020844-32020866 CCTGCTGTGGTGGGGTGGGGTGG - Intronic
1146730779 17:35192881-35192903 CCGTGAGGGGAGGGGTGGGGAGG + Exonic
1146954313 17:36928292-36928314 CCCTTGGGGGAGGGTAGGGGAGG - Intergenic
1146960065 17:36966758-36966780 CTTTCTTGGCAGGGGAGGGGAGG + Intronic
1147028291 17:37608984-37609006 CCTCTTGGGGTGGGGGGGGGCGG - Intronic
1147119150 17:38325447-38325469 GATTCTTGGGCGGGGAGGGGTGG + Intergenic
1147192058 17:38743771-38743793 CCTCCTGGGGTGGGGAGATGGGG - Intronic
1147325509 17:39667794-39667816 CTTTCTGGGGCGGGGTGGGGAGG + Intergenic
1147333667 17:39714101-39714123 CCCTCTGGAAAGGGGAGTGGAGG - Intronic
1147383674 17:40070015-40070037 TCTTTTGGGGCGGGGTGGGGAGG + Intronic
1147441080 17:40447562-40447584 CCTTGTGGGGAGGGGGAGGGAGG + Intronic
1147459844 17:40561215-40561237 CCGTCAGGGGAGGGGAGTTGGGG + Intronic
1147466678 17:40616179-40616201 CGTGGTGGGGAGGGGAGGAGAGG + Intergenic
1147561935 17:41514611-41514633 TCTTCTGGTGTGGGGTGGGGAGG - Intronic
1147575388 17:41595998-41596020 CCGTCTGGGGGAGGGAGGTGGGG - Intergenic
1147686553 17:42289551-42289573 CCCTCTGAGGAGGGGCAGGGCGG - Intronic
1147725735 17:42565208-42565230 GCTTCTGGGGAGGGGAACAGAGG - Exonic
1147878748 17:43640554-43640576 CTTTTTGGGGTGGGGAGGTGGGG + Exonic
1147972594 17:44227640-44227662 CCTTTCTGGGAGAGGAGGGGTGG - Intergenic
1148109852 17:45138173-45138195 CCCTTTGGGGAGAGGAGGGAGGG - Intronic
1148115553 17:45172709-45172731 GCATGTGGGGAGGGGAGGAGAGG + Intergenic
1148127789 17:45245783-45245805 TCTACTGGGCAGCGGAGGGGTGG + Intronic
1148171620 17:45525838-45525860 CCTGTTTGGGTGGGGAGGGGAGG - Intergenic
1148277750 17:46320571-46320593 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148299957 17:46538426-46538448 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148364402 17:47042711-47042733 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148466691 17:47869194-47869216 CCAGCTTGGCAGGGGAGGGGAGG - Intergenic
1148489514 17:48014100-48014122 GCCTCTGGGGAGGGTATGGGGGG + Intergenic
1148549562 17:48542417-48542439 CCCTCTGCTGAGGGGCGGGGAGG + Intronic
1148804180 17:50256037-50256059 CCATGTGGGGAGGTGAGGGTAGG - Intergenic
1148818358 17:50346428-50346450 CCTGCTGGGGAAGGGAGTGCCGG - Intronic
1148860958 17:50604136-50604158 CACCCTGGGGAGGGGAGGGAGGG - Exonic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1148895889 17:50838843-50838865 CCTTGAGGGGAGGAGAGGTGTGG + Intronic
1148907146 17:50918883-50918905 CCATGTGGGGTGGGGTGGGGTGG + Intergenic
1149626207 17:58082842-58082864 CCTTCCCGGAAGGTGAGGGGAGG + Intergenic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1150402546 17:64870873-64870895 CCTGTTTGGGTGGGGAGGGGAGG - Intronic
1150455627 17:65304582-65304604 CCTTCTCTGGGGGGGGGGGGGGG - Intergenic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1151322645 17:73361037-73361059 CGTTCTGCGGAGGGGGTGGGTGG + Intronic
1151450122 17:74193683-74193705 GCTCCTGGGGAGGGCAGAGGAGG - Intergenic
1151495900 17:74457877-74457899 TCTGGTGGGGAGGCGAGGGGTGG + Intergenic
1151539780 17:74759015-74759037 CCTGCTAGGGAGGGGTGAGGAGG + Intronic
1151992131 17:77582129-77582151 GCTTCTGGGTGGGGGTGGGGGGG + Intergenic
1152023584 17:77794784-77794806 ACTGCGGGGGAGGGGAGGTGGGG - Intergenic
1152166355 17:78710150-78710172 CCCCCTGAGGTGGGGAGGGGAGG + Intronic
1152239471 17:79153938-79153960 TCTTGAGGGGATGGGAGGGGCGG + Intronic
1152261377 17:79269089-79269111 CCTTCTGAGAAGGGGAGATGCGG + Intronic
1152344587 17:79743255-79743277 TGGGCTGGGGAGGGGAGGGGGGG + Intergenic
1152360992 17:79832881-79832903 GGTTCTGGGTAGGGGAGGAGGGG - Intergenic
1152581663 17:81168054-81168076 CCTCCTGAGCTGGGGAGGGGAGG - Intergenic
1152744778 17:82033618-82033640 CCTGCAGGGGAGGGGTGGGGAGG + Intronic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1153122418 18:1745228-1745250 TCTTCTGGGGTGGAGTGGGGCGG + Intergenic
1153202157 18:2656780-2656802 CCTTCTGGGGCGGGGCGGCGGGG + Intronic
1153450231 18:5219054-5219076 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
1153564565 18:6406562-6406584 TCCTCTGGGGAGGGGTGGAGGGG - Intronic
1153761920 18:8339808-8339830 CCTCCAGGCCAGGGGAGGGGTGG - Intronic
1153893672 18:9540479-9540501 CCAGCTGGGGAGGGGAAGGAAGG + Intergenic
1153915150 18:9738407-9738429 CCTCCAGGGAAGGGAAGGGGCGG + Intronic
1153982414 18:10321678-10321700 CCTGCTGGGGAGGGCAGGACTGG - Intergenic
1154166136 18:12015699-12015721 ACTTCTGGAGAGGGAAGGTGAGG - Intronic
1154202875 18:12311179-12311201 CCAGCTAGGGATGGGAGGGGTGG - Intronic
1155257943 18:24014746-24014768 CCGGGAGGGGAGGGGAGGGGAGG - Exonic
1155932662 18:31723957-31723979 CCTGGTGGGGTGGGGTGGGGTGG - Intergenic
1156180467 18:34597767-34597789 CATTCTGGGGGGGCGGGGGGCGG - Intronic
1156281440 18:35643093-35643115 CCTTTTGAGGAGGGGAGGAGAGG + Intronic
1156328851 18:36100678-36100700 CTTCTTGGGGAGGGCAGGGGTGG - Intergenic
1156830370 18:41484439-41484461 CATCCTGAGGAGGGGAGGTGAGG - Intergenic
1157221106 18:45829008-45829030 CTATCTGGGGCGGGAAGGGGAGG + Intronic
1157285415 18:46374082-46374104 CCTGGTGGGGAGGGGAGGTGGGG - Intronic
1157569616 18:48703833-48703855 CTTTCTGGAGAGGAGAAGGGAGG + Intronic
1157577226 18:48751495-48751517 CCTTGTGGTCTGGGGAGGGGAGG - Intronic
1157595174 18:48859837-48859859 TCTGATGGGGAGGGGAGAGGCGG - Exonic
1157867371 18:51197791-51197813 AGCTCTGGGGAGGGGAGGGGCGG - Intronic
1158554021 18:58460399-58460421 CCGGCTGGGGGGGGGGGGGGGGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158594575 18:58804903-58804925 GCATCTGGGGTGGGGAGTGGAGG - Intergenic
1158602134 18:58864145-58864167 CTGTCTGGGGAGGGGGCGGGGGG - Intronic
1158727213 18:59984456-59984478 GCTTTTGGGGCGGGGGGGGGGGG - Intergenic
1158832400 18:61294448-61294470 CTTTCTGGGGAGGACAGGGGAGG - Intergenic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1159899183 18:74027134-74027156 CCTTCTGGCGAGTGGAGGCAAGG + Intergenic
1159976855 18:74723925-74723947 TCTTCTGGTGTGGGGCGGGGTGG + Intronic
1160001211 18:75025591-75025613 CCTTTTGGGGAGAGGTGGTGGGG - Intronic
1160021439 18:75184951-75184973 TCTGCTGGGGAAGGGAAGGGAGG - Intergenic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160391214 18:78534770-78534792 CCTCCTGGGAAGGGCAGGGTGGG + Intergenic
1160506631 18:79430853-79430875 GTTTCTGGGGAAGGGAGAGGGGG - Intronic
1160519994 18:79501608-79501630 CTTTTTGGCGGGGGGAGGGGGGG - Intronic
1160551004 18:79693883-79693905 CCTGCAGGGGAGCGGAGGGGCGG - Intronic
1160699502 19:499017-499039 CGCTGTGGGCAGGGGAGGGGTGG - Intronic
1160703283 19:518174-518196 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160703351 19:518339-518361 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160745424 19:709068-709090 CGCGCGGGGGAGGGGAGGGGAGG - Intergenic
1160798556 19:956742-956764 CCTTCCGGGAAGGGGCTGGGGGG - Intronic
1160864560 19:1251050-1251072 CCATCGGGGGAGGGGCGGAGGGG + Intronic
1160909705 19:1468946-1468968 CTTTCTGGGCAGGGGCTGGGAGG - Exonic
1160910509 19:1471763-1471785 CATGCTGGGGATGGGACGGGAGG - Exonic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161076842 19:2289957-2289979 CCCGCGGGGGAGGGGAGGGGAGG + Exonic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161081505 19:2312814-2312836 CCTTCTGGGGACGGCCGTGGTGG - Intronic
1161139431 19:2638736-2638758 TCCCCTGGGGAGGGGAGGGGAGG + Intronic
1161153447 19:2721067-2721089 CCCTCCGGGTGGGGGAGGGGAGG + Intronic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161452695 19:4355197-4355219 CATTCTGGGGAGGGTTGGGAAGG + Intronic
1161500199 19:4610292-4610314 GCTTCTGCGGCGGGGAGGGGGGG + Intergenic
1161514550 19:4689398-4689420 CCTCCTGGGTAGGGCAGGGAAGG - Intronic
1161776333 19:6264243-6264265 CTTCCTGGGGTGGGGAGGGGTGG - Intronic
1162061816 19:8100820-8100842 GCTGTTGAGGAGGGGAGGGGTGG + Intronic
1162327875 19:10009478-10009500 GCAGCTGGGGTGGGGAGGGGGGG + Intronic
1162736901 19:12751917-12751939 CCTCCCGGGGCGGGGAGTGGAGG + Exonic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1162791369 19:13064720-13064742 GCTCCTGGGGAGGGGAGCTGAGG + Intronic
1162915182 19:13870923-13870945 CTTTCTGGGCAGGGGAGCTGGGG - Intronic
1163122386 19:15225823-15225845 CCCTCTGGGGTGGGGATGGGTGG - Intergenic
1163135795 19:15310363-15310385 CCTTCGGGGGGGGGGGGGGGGGG - Intronic
1163587826 19:18173556-18173578 CCTTTAGGGGAGGTGAGGTGGGG - Intronic
1163737548 19:18990618-18990640 CCTTCTGGGGAGGCTGGGGAGGG - Intergenic
1164668570 19:30059868-30059890 CCTTCTGGAGAGGCGGGTGGTGG - Intergenic
1164692516 19:30222128-30222150 ACTCTTGGGCAGGGGAGGGGTGG + Intergenic
1164693698 19:30228164-30228186 TCTGCTGGGGTTGGGAGGGGGGG + Intergenic
1164783157 19:30909673-30909695 TGTGCTGGGGAGGAGAGGGGAGG + Intergenic
1164893017 19:31840904-31840926 CCTAGTGGGGAGGAGAGGTGGGG + Intergenic
1164978948 19:32598165-32598187 CCTCTTGGGGAGTGGAGAGGGGG + Exonic
1165181905 19:33978942-33978964 GCCTCTGGGGATGGGAGAGGGGG - Intergenic
1165335961 19:35169783-35169805 CCTTCAGGGGCGGGCAGGGTTGG - Exonic
1165349673 19:35269049-35269071 CCCGGGGGGGAGGGGAGGGGAGG - Exonic
1165395998 19:35563798-35563820 GGATCTGGGCAGGGGAGGGGGGG - Intergenic
1165399341 19:35587947-35587969 CTTTCTGGAGGGGGGAGAGGTGG - Intergenic
1165404119 19:35619591-35619613 CCTGTGGGGAAGGGGAGGGGTGG - Exonic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165774991 19:38399105-38399127 CGTTTTGGGGAGGGGTGGGACGG + Intergenic
1165800463 19:38546358-38546380 CCTGCTGGGTAGGTGAGGAGGGG + Intronic
1165811461 19:38614350-38614372 GATTCTGGGGATGGGAGGGGAGG - Intronic
1165998007 19:39858847-39858869 CCACGCGGGGAGGGGAGGGGAGG + Intergenic
1166119552 19:40677420-40677442 CCCTATGGGGAGAGGATGGGCGG + Exonic
1166188646 19:41160210-41160232 CCTTCTTGGTAGAGAAGGGGAGG + Intergenic
1166215332 19:41331020-41331042 CCTGCCGGGGCGGGGCGGGGCGG + Exonic
1166276902 19:41760470-41760492 CCCTCTGCGGAGGGCAGGTGAGG - Intronic
1166423243 19:42654279-42654301 CCTTCCTGGGAGAGGACGGGAGG + Intronic
1166431404 19:42730811-42730833 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166434523 19:42756018-42756040 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166444403 19:42846046-42846068 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166447380 19:42869789-42869811 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166451847 19:42908606-42908628 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166454293 19:42927471-42927493 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166464090 19:43016800-43016822 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166470241 19:43073383-43073405 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166481371 19:43176903-43176925 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166483843 19:43196027-43196049 CCTTCTGCAGAGGGCAGGTGAGG + Intronic
1166490957 19:43259890-43259912 CCTTCTGCAGAGGGCAGAGGAGG + Intronic
1166561359 19:43734358-43734380 CTTTCTGGGGACTGGAGGGGTGG - Intronic
1166668458 19:44695658-44695680 CTCTCTGGGCAGGGGTGGGGAGG - Intergenic
1166826970 19:45615889-45615911 CCTGCGGGGGAGGGAAGGGATGG + Exonic
1166885157 19:45956136-45956158 TGTTCTGGGGTGGGGAAGGGGGG - Intronic
1167081113 19:47276525-47276547 CCCTCTGGGGAGTGGTGGTGGGG - Intergenic
1167114878 19:47483396-47483418 GGTTCAGGGGAGGGCAGGGGTGG + Intronic
1167200391 19:48061272-48061294 CCATGAGGGGAGGGGAAGGGAGG + Intronic
1167302193 19:48684619-48684641 CCTTCTGGTGAGGGACAGGGCGG - Intergenic
1167414141 19:49361601-49361623 CGCACGGGGGAGGGGAGGGGCGG - Intronic
1167426629 19:49432957-49432979 ACTTCTGTGGGGGCGAGGGGAGG + Exonic
1167437152 19:49486113-49486135 CATTCTGGGGAGGGAATGAGAGG - Exonic
1167555777 19:50194447-50194469 CCTCTTGGGGTGGGGGGGGGTGG + Intronic
1167602367 19:50461770-50461792 CCCAGTGGGGAGGGGAGGGCAGG - Intronic
1168063982 19:53909258-53909280 ACTGCGGAGGAGGGGAGGGGCGG - Intergenic
1168103980 19:54155595-54155617 CTCACTGGGGAGGGGAGGAGGGG - Exonic
1168257248 19:55173681-55173703 CCTTCTGGGGTGGGCGCGGGAGG + Exonic
1168291364 19:55359253-55359275 CCTTCTGGGATGGGGCAGGGAGG + Exonic
1168354369 19:55692397-55692419 CCAGCTGGACAGGGGAGGGGTGG + Intronic
1168378346 19:55899474-55899496 CCTTTTTGGGATGGGGGGGGTGG - Intronic
1168405489 19:56108276-56108298 AGTTCTGGGCAGGGGCGGGGTGG - Intronic
1168407231 19:56117029-56117051 CGTTCTGGGCAGGGCAGGGTGGG + Intronic
1202647013 1_KI270706v1_random:152495-152517 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
925131365 2:1496335-1496357 GCTCCTGGGGCGGGGCGGGGCGG + Intronic
925189061 2:1868560-1868582 CCTTCGGGGCCGGGGAGAGGGGG - Intronic
926007941 2:9387236-9387258 CCTTCAGGGGGGAGCAGGGGTGG + Intronic
926086823 2:10025617-10025639 TTTTCTGGGGGGGGGGGGGGCGG - Intergenic
926251312 2:11156767-11156789 CCCTGCGGGGTGGGGAGGGGGGG + Intronic
926890730 2:17637119-17637141 CCCTGTGGGAAGGGGAAGGGAGG - Intronic
926918099 2:17912634-17912656 CCCCCTGGGGAATGGAGGGGAGG - Intronic
927186392 2:20485523-20485545 TCTTCTCAGGAGGGGAGGGAAGG - Intergenic
927554085 2:24020443-24020465 GCCTCTGGGGAGGGGAGGAGAGG - Intronic
927679791 2:25131954-25131976 CGGAGTGGGGAGGGGAGGGGAGG + Intronic
927900876 2:26817439-26817461 CCATCTCGGGGGGGGGGGGGGGG - Intergenic
927982031 2:27380434-27380456 CCTTGAGGGGAGAGGAGCGGGGG - Intronic
928245333 2:29621771-29621793 GCTTCTGGAGAGGTGAGGGCTGG + Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928301720 2:30131050-30131072 CTGTGTGGGGAGGGGAGTGGAGG + Intergenic
928931884 2:36633327-36633349 CCTACTGGAGAGGGGAGGGAGGG - Intronic
929347156 2:40898228-40898250 CCTGGTGGGGTGGGGAGGTGGGG + Intergenic
929436868 2:41935512-41935534 CTGTCTGGTGTGGGGAGGGGAGG - Exonic
929768981 2:44875479-44875501 TCTTCTAGGCAGGGGAGTGGAGG + Intergenic
929819094 2:45259137-45259159 CCTTCTGTGTAAAGGAGGGGCGG + Intergenic
930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG + Intergenic
930103113 2:47618120-47618142 CCTTCTGGGGAAGGGAAGGGAGG + Intergenic
930475897 2:51881723-51881745 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
930651826 2:53971066-53971088 ACTTCCGGGGCGGGGCGGGGCGG + Intronic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930977447 2:57480702-57480724 TGTTGTGGGGAGGGAAGGGGTGG - Intergenic
930997471 2:57737879-57737901 CCTTGTGGGGAGGGGACAGGTGG - Intergenic
931297629 2:60944408-60944430 GATTCTGGGGAGAGGAGCGGGGG + Intronic
931664124 2:64598170-64598192 CCTTCAGGGGAGGGATGGTGAGG - Intergenic
931854857 2:66292406-66292428 CCTTCTGCGGGGGGGTGGTGGGG + Intergenic
931882065 2:66577984-66578006 CTTTCTGGGCATGGGTGGGGTGG + Intergenic
932447137 2:71787892-71787914 GCCTCTGTGGAGGGGAGGGGTGG - Intergenic
932701804 2:73997293-73997315 TCTTCTGGGGAGGACATGGGTGG + Intronic
932745046 2:74327000-74327022 CCTTGTGGATAGGGAAGGGGTGG - Intronic
932893195 2:75613343-75613365 CCTGCGGGGGGGGGGGGGGGGGG + Intergenic
933392539 2:81690132-81690154 GCCTAAGGGGAGGGGAGGGGAGG + Intergenic
933774529 2:85764208-85764230 GCTTCTGGGGAGCATAGGGGAGG + Intronic
934067085 2:88350547-88350569 CCACCGGGGGAGGGGAGGGGTGG - Intergenic
934088112 2:88527144-88527166 ACTTCTGGAGATGGGAGGAGGGG - Intronic
934290540 2:91686981-91687003 CTCTCTGGGGCGGGGGGGGGGGG - Intergenic
934601804 2:95663634-95663656 CCTTCAGGGGAGGGGGACGGGGG + Intergenic
934869352 2:97847065-97847087 GCTACTGGGGGGGGGGGGGGGGG + Intronic
935038657 2:99404315-99404337 TCCACTGGGGAGGGGAGGGGAGG - Intronic
935271244 2:101436071-101436093 TCTGCTGGGGAGGGGAGAAGAGG - Intronic
935275882 2:101474757-101474779 CCTCTTGGGGTGGGGTGGGGCGG - Intergenic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
936037332 2:109123386-109123408 GCTTCAGGGGAAGGGAGGGAGGG - Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936103613 2:109604711-109604733 GACTCTGGGGAGGGGAGGGGAGG + Intronic
936147762 2:109992637-109992659 CCTTCCAGGGAGGGAAGGAGAGG + Intergenic
936196929 2:110378810-110378832 CCTTCCAGGGAGGGAAGGAGAGG - Intergenic
936535156 2:113305789-113305811 CCTTCAGGGGAGGGGGACGGGGG + Intergenic
936577404 2:113668071-113668093 CCCTCTGGGCAGGGGAAGAGTGG - Intergenic
936709624 2:115117799-115117821 CCTTAAGGGTCGGGGAGGGGAGG + Intronic
937129858 2:119501463-119501485 CCTGCTGGGAAGGGTGGGGGAGG + Intronic
937226744 2:120374721-120374743 CTCCCTGGGAAGGGGAGGGGAGG + Intergenic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
937357795 2:121209171-121209193 CTCTCTGGGACGGGGAGGGGTGG - Intergenic
937428122 2:121816615-121816637 CCTTCTGGGTGGGTGAGAGGAGG + Intergenic
937910405 2:127073018-127073040 CCTGCTGTGGGGGGGAGGTGGGG - Intronic
937974727 2:127575649-127575671 GGTTCTGGGGCGGGGAGGAGGGG + Intronic
938051383 2:128175743-128175765 GCTCCTGGGAAGGGGAGGGCTGG - Intronic
938318527 2:130346296-130346318 GTGTCTGGGGTGGGGAGGGGAGG + Intronic
938568322 2:132540325-132540347 GCATCAGGGGAGGGGAGGAGAGG + Intronic
938793766 2:134701465-134701487 CCTTCTGGGCAGAGCTGGGGAGG - Intronic
939423111 2:141999236-141999258 CATGATGGGGAGGGGAGGGTCGG - Intronic
939948880 2:148444805-148444827 CTGTCTGGGGAGCAGAGGGGTGG - Intronic
940450970 2:153836653-153836675 CGTTGTGGGGAGGGGGGAGGGGG - Intergenic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
941003252 2:160222615-160222637 CCTTCTGGAGAGGGGAATTGGGG + Intronic
941019188 2:160389844-160389866 TCTGGTGGGGAGGGGAGGAGAGG + Intronic
941651159 2:168094079-168094101 CATGCTGGGGAGGGCTGGGGAGG - Intronic
941927032 2:170906128-170906150 CTGTCTGGGGAGAGGAGTGGCGG - Intergenic
941987418 2:171522748-171522770 CCTCCTGGGGGGGTGCGGGGAGG + Intronic
942049286 2:172123849-172123871 CCTGCTGGGGAGGGGGGCCGGGG - Intergenic
942064264 2:172255343-172255365 GCTTCTGGAGAGGGGAGTGGTGG - Intergenic
942198076 2:173542672-173542694 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
944294859 2:198050410-198050432 GGTTGTGGGGAGGGCAGGGGAGG + Intronic
944989982 2:205224521-205224543 GCTTCTGGGGAGTGGCGGTGGGG - Intronic
945118898 2:206438421-206438443 CCTACTGGGGGTGGGAGTGGGGG - Intergenic
945160924 2:206889688-206889710 CCTTCTTGAGAGTGGAGGGAAGG - Intergenic
945412508 2:209528099-209528121 TTTTCTGGGGTGGGCAGGGGGGG - Intronic
945435194 2:209809976-209809998 CCTTCGGGGAAGGAGTGGGGAGG - Intronic
945758248 2:213877600-213877622 CCTTATGTGGATGGGAGTGGTGG - Intronic
946172319 2:217902719-217902741 CCGGGCGGGGAGGGGAGGGGAGG + Intronic
946306346 2:218859112-218859134 CGTTCTAGGGCGGGGAGGTGGGG - Intergenic
946327715 2:218993342-218993364 TCTGCTGGGGTGGGGAAGGGAGG - Exonic
946351856 2:219160569-219160591 CCTCCGGGGGAGGGGTGGGCGGG - Intronic
946386719 2:219388104-219388126 CTTCCTGGCGAGGGGCGGGGCGG - Intronic
946391284 2:219418308-219418330 CTGTCAGGGGAGGGGAGGCGGGG + Intergenic
947103826 2:226648283-226648305 CATGGTGGGGTGGGGAGGGGAGG - Intergenic
947360293 2:229339622-229339644 TTTTCGGGGTAGGGGAGGGGTGG - Intergenic
947399366 2:229715476-229715498 CCTACTTCGGAGGGGATGGGGGG + Intergenic
947712606 2:232324643-232324665 CTTTGTGGTGAGGGTAGGGGAGG + Intronic
948046820 2:234951858-234951880 GCTTCGGGAGAGGGGCGGGGCGG - Intergenic
948048563 2:234962036-234962058 ACTTCTTGGGTGGGGTGGGGAGG + Intronic
948362458 2:237432740-237432762 GGTTCTGGGGAAGGGAAGGGAGG + Intergenic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948669242 2:239556590-239556612 CCTGTTGGGGAGGTGGGGGGAGG - Intergenic
948745420 2:240089389-240089411 CCGTCTGGGGAGTGGGGGTGGGG - Intergenic
948824208 2:240566554-240566576 CCTCCTCGGGCGGGGCGGGGCGG + Intronic
948827411 2:240579353-240579375 TGTCCTTGGGAGGGGAGGGGAGG - Exonic
948846497 2:240685228-240685250 CCCGCTGGGGAAGGGCGGGGAGG - Intergenic
948847365 2:240689505-240689527 CCCGCTGGGGAAGGGCGGGGAGG + Intergenic
948867293 2:240782499-240782521 CCCTGTGGTGAGGGGCGGGGCGG - Intronic
948887888 2:240893064-240893086 AGTACTGGGGAGGGGAGGGGCGG - Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1168910814 20:1445250-1445272 CCTTGTGGGGAGGGAGGTGGAGG + Intronic
1168935876 20:1665012-1665034 CCTGCTGGGGAGGTGAGAAGAGG - Intergenic
1169030199 20:2400722-2400744 CTTCCTGGGGTGGGGTGGGGTGG + Intronic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169132390 20:3173042-3173064 TCTGCTGGGGGTGGGAGGGGGGG + Intronic
1169191792 20:3662674-3662696 CCCTTTGGGGAGGGGAGGAAGGG - Intronic
1169509904 20:6252202-6252224 ACTTCTGGAGAGGGGAAGGAGGG + Intergenic
1170270303 20:14520056-14520078 CCTTCTGGAAAGTGGAGGGAGGG + Intronic
1170297008 20:14838854-14838876 AGTTCTGGGGAGTGAAGGGGAGG - Intronic
1170572689 20:17641356-17641378 CCTTGTGGGGAGGGGACTGGAGG - Intronic
1170606390 20:17878039-17878061 CTTACTGGGGATGGGAGGGCAGG + Intergenic
1170652921 20:18258907-18258929 GATCCTGGGGAGGGGAGGGTTGG + Intergenic
1170859231 20:20087285-20087307 ACTTCTAGGGAGGGGAGAGAAGG - Intronic
1170917532 20:20642100-20642122 CCGAGAGGGGAGGGGAGGGGAGG + Intronic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1171215128 20:23346818-23346840 CCTCCTGGGCAGCAGAGGGGTGG + Intergenic
1171447482 20:25215024-25215046 CCACATGGGGCGGGGAGGGGTGG - Intronic
1171891810 20:30724336-30724358 CCTTCCGAGGAGGAGCGGGGTGG - Intergenic
1172232528 20:33346735-33346757 CCTTGTGGGGGGGGGGGGGGGGG + Intergenic
1172408097 20:34704185-34704207 CCGGGAGGGGAGGGGAGGGGAGG + Intronic
1172690544 20:36786506-36786528 CCAGCTGGGGTGGGGAGGAGAGG - Exonic
1172711660 20:36929341-36929363 CCCTCAGGGCAGGGGAAGGGAGG - Intronic
1172886129 20:38232026-38232048 CCTCATGGGGAGGAAAGGGGAGG + Intronic
1172958510 20:38779511-38779533 CCGTCTTGGGAGGCGGGGGGGGG + Intergenic
1173570440 20:44072139-44072161 CCTTCTGGGGTTGGGGGAGGGGG - Intergenic
1173817860 20:46001402-46001424 CCTTCTAGGAAGGGGACTGGAGG + Intergenic
1173919143 20:46730996-46731018 CATTCTGGGGTGGGGAGGACTGG - Intronic
1174032226 20:47638913-47638935 CATTCTTGGGTGGGGAGTGGTGG + Intronic
1174039459 20:47688640-47688662 CCTTCTTGGGTGGAGAGGAGTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174146237 20:48454742-48454764 CCTTCTGGGAAGGGGAGTCGGGG - Intergenic
1174371580 20:50092399-50092421 TCTGCTGGGAAGGGGAAGGGAGG + Intronic
1174399153 20:50266745-50266767 CCTTCTAGGGAGGGGTTGTGTGG - Intergenic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174536917 20:51258464-51258486 ACCTCTGGGGAGGGCTGGGGAGG - Intergenic
1174917799 20:54671585-54671607 CTTTTTAGGGAGGAGAGGGGTGG - Intergenic
1175113835 20:56667776-56667798 CATGGAGGGGAGGGGAGGGGAGG + Intergenic
1175216228 20:57392854-57392876 ACTGCTGGGGCGAGGAGGGGGGG - Intronic
1175301645 20:57947332-57947354 CCTTCATGGCAGGGGTGGGGTGG + Intergenic
1175340056 20:58222804-58222826 CTTTGCGGGGAGGGGTGGGGCGG + Intronic
1175388241 20:58610796-58610818 AGACCTGGGGAGGGGAGGGGAGG - Intergenic
1175847879 20:62068068-62068090 CCTTCCGGGGGGGGGGGGAGGGG + Intergenic
1175996381 20:62813912-62813934 CCTTCTGGAGTGGGGGGCGGCGG + Exonic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176218144 20:63957829-63957851 TCATGAGGGGAGGGGAGGGGAGG - Exonic
1176223173 20:63979550-63979572 CCGGCTGGGGCGGGGCGGGGCGG - Exonic
1176284914 21:5014367-5014389 CCATCTGGGGGCGGGAGGGTCGG - Intergenic
1176285491 21:5016916-5016938 CCTGCTGCTGAGAGGAGGGGAGG - Intergenic
1176348308 21:5770718-5770740 CCTTCTGGGGGGGAGAGAGGTGG - Intergenic
1176355122 21:5891302-5891324 CCTTCTGGGGGGGAGAGAGGTGG - Intergenic
1176389945 21:6158289-6158311 CCTTCTGGGGCTGGGAGGTCAGG - Intergenic
1176423404 21:6533401-6533423 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1176496519 21:7553737-7553759 CCTTCTGGGGGGGAGAGAGGTGG + Intergenic
1176542629 21:8168788-8168810 CCTTCTGGGGGGGAGAGAGGTGG - Intergenic
1176561580 21:8351833-8351855 CCTTCTGGGGGGGAGAGAGGTGG - Intergenic
1176604856 21:8820279-8820301 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1176625369 21:9087639-9087661 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1176925246 21:14741305-14741327 CCTTGTGGGGCTGGGAAGGGAGG - Intergenic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1177167778 21:17622274-17622296 CCTCCTGGGCTGGGGTGGGGTGG - Intergenic
1178339656 21:31775204-31775226 CCATTAGGTGAGGGGAGGGGGGG - Intergenic
1178404053 21:32310332-32310354 CATGATGGGGGGGGGAGGGGAGG + Intronic
1178425777 21:32477734-32477756 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178425807 21:32477796-32477818 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178425835 21:32477858-32477880 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178752909 21:35321344-35321366 CCTCGTGGTGAGGGGAGGGGAGG + Intronic
1178951188 21:36987149-36987171 CATTGTGGGAAGGGGAGGGAAGG - Intronic
1179112007 21:38455477-38455499 CCTTCTGAAGAGGAGAGAGGTGG - Intronic
1179511577 21:41877303-41877325 TGTTCTGGGCAGGGGAGTGGAGG - Intronic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179698898 21:43141717-43141739 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1179733521 21:43379951-43379973 CCTTCTGGGGCTGGGAGGTCAGG + Intergenic
1179871690 21:44246559-44246581 CCTGCTGCTGAGAGGAGGGGAGG + Exonic
1179872267 21:44249108-44249130 CCATCTGGGGGCGGGAGGGTCGG + Exonic
1179874687 21:44261949-44261971 CCCGCGGGGGCGGGGAGGGGCGG + Exonic
1179924657 21:44527894-44527916 GCTGCTGGGGAGGTGAGTGGAGG - Intronic
1179951722 21:44712124-44712146 TCTGCTGTGGTGGGGAGGGGGGG + Intergenic
1180164978 21:46020630-46020652 TCTCCTGGGGTGGGGTGGGGGGG - Intergenic
1180347146 22:11711884-11711906 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180354894 22:11829974-11829996 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180383357 22:12162357-12162379 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180769330 22:18369279-18369301 TCTTGTGGGGTGGGGGGGGGAGG - Intergenic
1180815981 22:18789842-18789864 CCTTGGGGGGAGGGGGGAGGGGG + Intergenic
1180911364 22:19453126-19453148 CCTTCTGGGATGGGGGAGGGAGG + Intronic
1181202168 22:21224177-21224199 CCTTGGGGGGAGGGGGGAGGGGG + Intronic
1181281107 22:21721122-21721144 TTTTTTGGGGGGGGGAGGGGAGG + Intronic
1181365887 22:22376905-22376927 ACTACTGGGGATGGAAGGGGAGG - Intergenic
1181372323 22:22428427-22428449 ACTACTGGGGATGGAAGGGGAGG - Intergenic
1181419333 22:22786907-22786929 CCTCTTGGGGAGGAGGGGGGAGG - Intronic
1181522624 22:23458372-23458394 GCTGCTGGGCAGGGGTGGGGAGG - Intergenic
1181639889 22:24190873-24190895 CCTGCTGGAAAGGGGAGGTGGGG - Intergenic
1181778830 22:25178503-25178525 CCTGGTGGGGAGGGGCGGCGGGG + Intronic
1181830821 22:25558928-25558950 CTCCCTGGGGAGGGTAGGGGTGG + Intergenic
1181851123 22:25750705-25750727 CCTTGTGGCCAGTGGAGGGGAGG + Intronic
1181984251 22:26788410-26788432 CCTGTTGGGGAAGGGCGGGGTGG - Intergenic
1182115549 22:27754391-27754413 CCTGCTGGGGTGGGGAGAAGGGG - Intronic
1182281335 22:29219313-29219335 GCCCATGGGGAGGGGAGGGGAGG - Intronic
1182438254 22:30345237-30345259 GCTCCAGGGGAGGGGAGGGGAGG + Intronic
1182610074 22:31540175-31540197 CCTTCTGGCACGGGGTGGGGGGG + Intronic
1182842201 22:33400387-33400409 CCATCTGGGGGAGGGATGGGAGG + Intronic
1183303352 22:37069341-37069363 CATGCTGGGGTGGGGTGGGGTGG + Exonic
1183358320 22:37371031-37371053 TCTCCTGGGGCGAGGAGGGGAGG - Exonic
1183452864 22:37906283-37906305 CCGGCAGGCGAGGGGAGGGGCGG - Exonic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183537892 22:38413681-38413703 GCCTTTGGGGAGGGGAGGGAAGG - Intergenic
1183744391 22:39684769-39684791 GCTTGAGGGGAGGGGAGGAGAGG + Intronic
1184066504 22:42124660-42124682 TGACCTGGGGAGGGGAGGGGAGG + Intergenic
1184068972 22:42136812-42136834 TGACCTGGGGAGGGGAGGGGAGG + Intergenic
1184269453 22:43370502-43370524 GCCTCTGGGGAGGGGACAGGAGG - Intergenic
1184271875 22:43389011-43389033 GCCTCTGGGGTGGGGAGGTGGGG - Intergenic
1184512780 22:44942998-44943020 CCTTCTGAGGATGGGGGGGGGGG - Intronic
1184538224 22:45101933-45101955 CCTTCTAGGGTGAGGTGGGGGGG + Intergenic
1184598331 22:45527583-45527605 CATGTTGGGGTGGGGAGGGGAGG + Intronic
1184598997 22:45531716-45531738 CTGGCTGGGGAGGGGAAGGGTGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1184885813 22:47343840-47343862 GCATTTGGAGAGGGGAGGGGAGG + Intergenic
1185149584 22:49156371-49156393 CCTCCTGGAGAGAGGAGAGGAGG - Intergenic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
1185186253 22:49402267-49402289 CCCTGTGGGGAGGGGAGTGAGGG - Intergenic
1185422829 22:50744593-50744615 CCCTCTGGGCAGGGGAAGAGTGG + Intronic
1203224741 22_KI270731v1_random:71251-71273 CCTTGGGGGGAGGGGGGAGGGGG - Intergenic
1203247494 22_KI270733v1_random:85031-85053 CCTTCTGGGGGGGAGGGAGGTGG - Intergenic
1203266084 22_KI270734v1_random:15534-15556 CCTTGGGGGGAGGGGGGAGGGGG + Intergenic
949576812 3:5346120-5346142 CCTTTTGGGGTGGAGAGGGAGGG + Intergenic
950260574 3:11540902-11540924 TTTTTTGGGGGGGGGAGGGGGGG + Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
950545853 3:13637503-13637525 CCGTCTGGGGATGAGGGGGGTGG + Intronic
950630473 3:14278700-14278722 ACTTCTGGGGTGGGGAAAGGAGG - Intergenic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
950769649 3:15301303-15301325 ACTTCAAGGGAGGGCAGGGGAGG + Intronic
950965076 3:17140300-17140322 CCTTCTGGGGTTGGGATGTGGGG + Intergenic
950972038 3:17198695-17198717 CGTTCTGGGAAGGGCAGGGCAGG + Intronic
951715060 3:25633521-25633543 ACCTCTGGGGAGAGGAGAGGGGG - Intronic
952853920 3:37752159-37752181 CCTACTGAGCAAGGGAGGGGCGG - Intronic
953217733 3:40936983-40937005 CCTTCTGGGGAGGGTTGGAAAGG + Intergenic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
953569349 3:44058871-44058893 CAGTCGGGGGTGGGGAGGGGGGG - Intergenic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
953918261 3:46934607-46934629 CCTTCTGGGTAGGGTGGGGTAGG - Intronic
954197053 3:49003104-49003126 ACTGCTGGGGAGGGGTGGGCAGG + Intronic
954332407 3:49898015-49898037 CCTTCAGGGAAAGGGAGGGGAGG + Intronic
954401778 3:50322925-50322947 CCTACTCGGGAAGGGTGGGGAGG - Intronic
954445063 3:50542054-50542076 CCCTCTGTGGGGAGGAGGGGAGG + Intergenic
954630438 3:52045029-52045051 CCCTCAGGGGAGGTGAGTGGGGG + Intergenic
954783432 3:53076271-53076293 CCCTCTGGGGAAGGGAGGCAGGG + Intronic
954838254 3:53490114-53490136 CCTTTAGGGAAGGGGAGGTGGGG + Intergenic
955352958 3:58207442-58207464 ACTTCTGGTGGGGGGGGGGGGGG - Intronic
955356582 3:58237457-58237479 CGTTCCGGGGCGGGGCGGGGCGG + Intergenic
956023535 3:64957929-64957951 CCTTCTGTGGAGGGAAGTGGGGG - Intergenic
956452069 3:69385244-69385266 CAGGCTGGGGAAGGGAGGGGTGG - Intronic
956474698 3:69607876-69607898 CACTCTGGGGAGGAGAGGGAGGG + Intergenic
956785869 3:72641657-72641679 CCTTGTCGGGAGGCGGGGGGTGG + Intergenic
956933236 3:74070342-74070364 CCTACTTGGGAGTGGAGGGTGGG + Intergenic
957699392 3:83689060-83689082 TGTTGGGGGGAGGGGAGGGGAGG - Intergenic
957784218 3:84860359-84860381 CCTCCTGAGGAGGGGAGAGCTGG - Intergenic
957824534 3:85423278-85423300 CATTATGGGCAGGGGAGGGGTGG + Intronic
958427590 3:93997061-93997083 CCATCTGGGGGGGTGATGGGAGG - Intronic
958531772 3:95341593-95341615 CCCTCTGGGGGGTGGCGGGGAGG - Intergenic
958642482 3:96824885-96824907 CCTTTGCGGGAGGGCAGGGGCGG - Intronic
958731189 3:97962357-97962379 CCATGTGGGGGGGGGGGGGGGGG - Intronic
958862283 3:99458384-99458406 CCTGCAGGGGAGAGGAGGAGGGG + Intergenic
959765374 3:110020735-110020757 CCTGTTGGGGAGGGTGGGGGTGG + Intergenic
959787377 3:110316766-110316788 ACTGAGGGGGAGGGGAGGGGAGG + Intergenic
959961344 3:112302629-112302651 CCATCTGGGGAGGGGCGCTGGGG - Intergenic
960962795 3:123083917-123083939 GCTTATGGGGAGGGGAGGAAAGG + Intronic
960969577 3:123130042-123130064 CCCACTGGGCAGTGGAGGGGAGG - Intronic
960975515 3:123169926-123169948 CCTCATGGGGAAGGGAGGAGGGG + Intronic
961008898 3:123423305-123423327 CCTTCTCCGCAGGGGTGGGGCGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961492212 3:127263880-127263902 CCTTCACTGGAGGTGAGGGGGGG - Intergenic
961819482 3:129567933-129567955 CCTCCTGGGCAGGGTTGGGGTGG + Intronic
962010398 3:131385536-131385558 CCTTTTGAGGAAGGGAGGGTGGG + Intronic
962194863 3:133352889-133352911 ACCTCTGGGGAGAGGAGGAGAGG - Intronic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
962604913 3:137025103-137025125 CCCACTGAGGAGTGGAGGGGTGG + Intergenic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
964044439 3:152306256-152306278 AATGCTGGGGAGGGTAGGGGAGG - Intronic
964150021 3:153512649-153512671 CCTTCTGGGAAGGGAAAGAGTGG - Intergenic
964164224 3:153682064-153682086 CTTCATGGGGAGGGGAAGGGGGG + Intergenic
964247603 3:154671658-154671680 CCTACAGGCCAGGGGAGGGGAGG - Intergenic
964379088 3:156079301-156079323 GCTTCTGGAAAGGGGAGGGAAGG - Intronic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965520200 3:169662945-169662967 CCTGGGGGGAAGGGGAGGGGAGG + Intronic
965592046 3:170370440-170370462 CCTGCTCGGGGGGGGGGGGGGGG - Intronic
966816649 3:183895404-183895426 CCTTCTGGTCAGGAGAGGGCAGG + Intergenic
967142104 3:186570074-186570096 ACTTGGGAGGAGGGGAGGGGTGG + Intronic
967314091 3:188134460-188134482 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
967417419 3:189234213-189234235 ACTTGTGGGTAGGGGAGGTGAGG + Intronic
967451890 3:189633645-189633667 ACTTTTGGGGAAGGCAGGGGAGG + Intronic
967857804 3:194131441-194131463 CCTTCCGGGGCGGGGGTGGGGGG + Intergenic
968009359 3:195263561-195263583 GCTTCTGGGGAGGGAAGCAGAGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968161767 3:196432504-196432526 ACCGCTGGGGACGGGAGGGGCGG - Intergenic
968199482 3:196740051-196740073 CGGTGCGGGGAGGGGAGGGGAGG - Exonic
968234346 3:197022941-197022963 CCTTCCGGTGAGCGGAGTGGGGG - Exonic
968260003 3:197313643-197313665 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
968483950 4:849838-849860 CCTTCAGGGGCGGGGCGGGGGGG - Intronic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968700939 4:2058272-2058294 CCTGGTGGGGTGGGGAGGGGCGG - Intergenic
968861260 4:3172561-3172583 CCTCCTGGGGAGTGAAGGGAAGG - Intronic
968876331 4:3269672-3269694 CCCTCTGTGGGGTGGAGGGGCGG - Intronic
968939594 4:3631053-3631075 CCTCCTGGGGTGGGGTGGGAGGG + Intergenic
968942444 4:3645868-3645890 GGTTCTGGGGAGAGCAGGGGTGG - Intergenic
968963620 4:3758268-3758290 CCGGCTGAGGCGGGGAGGGGCGG + Intergenic
969033354 4:4230659-4230681 TCTTGTGGGGTGGGGTGGGGAGG - Intergenic
969112358 4:4851969-4851991 GGGACTGGGGAGGGGAGGGGAGG - Intergenic
969298558 4:6283737-6283759 CCTTCTGTGCAGCGCAGGGGAGG + Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969392580 4:6901301-6901323 CAGTCAGGGGAGGGGTGGGGAGG + Intergenic
969720846 4:8892543-8892565 GCGTGGGGGGAGGGGAGGGGTGG - Intergenic
969869373 4:10095135-10095157 CATTCTCAGGAGGCGAGGGGCGG + Intronic
970525634 4:16929142-16929164 ACCTCTGAGGAGGGGAGAGGAGG + Intergenic
970758672 4:19456387-19456409 GCTGCTGGGGAGGTGACGGGAGG + Intergenic
971036033 4:22693739-22693761 CCCTTTGTGGAGGGGAAGGGGGG - Intergenic
971268413 4:25114680-25114702 CCTTCCTGGGATGGGAGAGGTGG - Intergenic
971374446 4:26045553-26045575 CCTTGTGGAGTGGGGTGGGGAGG - Intergenic
971538637 4:27786651-27786673 CCTTTTGGGGGTGGGGGGGGTGG + Intergenic
971763065 4:30794044-30794066 CTCACTGGGGAGGGGAGGAGAGG - Intronic
971873996 4:32280742-32280764 CCTTCTGGGGGTGGGGGGGAAGG + Intergenic
972030454 4:34450746-34450768 ACTTCTGGGGAGGGAAGTGAGGG + Intergenic
972553807 4:40160985-40161007 CCTTCTGGGGGTGGGAAGGAGGG - Intergenic
973712199 4:53641188-53641210 TGTTCTGGGGAAGGGCGGGGTGG + Intronic
973719391 4:53707788-53707810 CCGGCTGGGGAGGGGTGGGGTGG + Intronic
974192391 4:58523040-58523062 AGTGCAGGGGAGGGGAGGGGAGG - Intergenic
974345099 4:60669312-60669334 CTTTCTGTAGAGGGGAGTGGAGG - Intergenic
974444608 4:61963412-61963434 CCTTCTTGAGAGTGGAGGGTGGG - Intronic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
976004634 4:80414691-80414713 CCTTCAGGGGATGGGCAGGGAGG - Intronic
976150593 4:82087515-82087537 TCTTCTGGGGTGGGGGGAGGGGG - Intergenic
976220665 4:82754519-82754541 GCTGCTGGTGAGGGGAGGGTGGG - Intronic
976501716 4:85797818-85797840 CATTCTGAGGAGGGCAGGGTTGG - Intronic
976740306 4:88349548-88349570 CCCCCTGGGGTGGGGATGGGAGG - Intergenic
976778922 4:88737397-88737419 CATTCACCGGAGGGGAGGGGAGG + Intronic
977177966 4:93838782-93838804 GTTTGTGGGGTGGGGAGGGGGGG + Intergenic
977895400 4:102358888-102358910 TCTTCTGGGGAGTGGAGAGTGGG - Intronic
977997977 4:103517655-103517677 GGTTGGGGGGAGGGGAGGGGAGG - Intergenic
978147340 4:105391178-105391200 CCTGCTGGTGGGGGGAGGGGAGG + Intronic
978505632 4:109453442-109453464 CATTCGGGGGGGGGGGGGGGGGG - Intronic
978600185 4:110419243-110419265 CCGTCTGGGGCAGGGCGGGGCGG + Intronic
978629713 4:110730325-110730347 CCTGTCGGGGTGGGGAGGGGAGG - Intergenic
978980686 4:114941335-114941357 TACTTTGGGGAGGGGAGGGGAGG - Intronic
979241740 4:118453091-118453113 TCTTGAGGGGAAGGGAGGGGAGG + Intergenic
979733423 4:124052579-124052601 CCTTGAGGGGAGGGGAAGAGGGG + Intergenic
979786324 4:124719163-124719185 TATGCTGGGGAGGGGAGGGGAGG + Intergenic
980455006 4:133028029-133028051 ACTACTGGAGAGGGGAGGGTGGG + Intergenic
980604676 4:135074788-135074810 TCTTATGGGGTGGGGAGAGGGGG - Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
981051808 4:140316673-140316695 CCTTCTGGGGTGCAGTGGGGTGG - Intronic
981429821 4:144645971-144645993 CCTGCTGCGGCGGGGAGGGGCGG - Intergenic
981517139 4:145621581-145621603 CCTTCTGTGGTTGGGGGGGGTGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982149322 4:152435060-152435082 AGGCCTGGGGAGGGGAGGGGAGG + Intronic
982421946 4:155208682-155208704 CCTGCAGGGGAGGGGACTGGAGG - Exonic
982465297 4:155722992-155723014 ACCTCTGGGGAGGAGAGTGGGGG - Intronic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984706540 4:182851266-182851288 CACTCTGAGGAGTGGAGGGGGGG - Intergenic
984793605 4:183636903-183636925 ACTGTTGGGGAGTGGAGGGGGGG - Intergenic
984895968 4:184540177-184540199 CTTTTAGGGGAGGGGAGGAGTGG + Intergenic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985011574 4:185587967-185587989 CCTGCTGAGGAGGGGGGCGGAGG + Intronic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985133911 4:186766345-186766367 CCCTGTGGGGAGGGGTGGCGGGG + Intergenic
985249102 4:188005361-188005383 CCTTCTGAGGCTGGGAGGGAAGG + Intergenic
985580667 5:693755-693777 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
985595291 5:785087-785109 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
985632522 5:1021421-1021443 CCCTGTGGGGAGGGGCTGGGGGG - Intronic
985638357 5:1051380-1051402 GCTCCTGGGGTGGGGTGGGGTGG + Exonic
985657136 5:1138016-1138038 ACTTCTGAGAAGAGGAGGGGCGG - Intergenic
985758553 5:1733337-1733359 CCATGGGGGGTGGGGAGGGGAGG - Intergenic
986192651 5:5511426-5511448 CCTTCTGGGGAGTGCAGGATGGG - Intergenic
986488917 5:8269478-8269500 GCTCCTGTGGAGGTGAGGGGTGG + Intergenic
986503415 5:8425687-8425709 CCTTCTGCGGGGTGGAGGGTTGG - Intergenic
986710143 5:10482656-10482678 CCTGGTGGGAAGGGGAGGGATGG + Intergenic
986737125 5:10676094-10676116 CCTTCACTGGAGGGGAGGGTAGG - Intergenic
986804963 5:11300805-11300827 CCTTGAGGGGATGGGAGTGGAGG - Intronic
987256651 5:16161181-16161203 CTTTCTGGGGTGGGGGGAGGGGG - Intronic
987358254 5:17083684-17083706 CCCGCGGGGAAGGGGAGGGGAGG + Intronic
987804498 5:22745755-22745777 CCTTTTGGAGAGTGGAGGGTGGG + Intronic
989188761 5:38649673-38649695 TTTTCTGGGGGGGGGATGGGGGG - Intergenic
990075580 5:51842927-51842949 CCTGCGGGGGGGGGGGGGGGGGG - Intergenic
990491967 5:56311400-56311422 CCTTCTGGAGAGGGCAGTGTTGG + Intergenic
991963931 5:72072643-72072665 CCTTCTGACTAGGGCAGGGGTGG - Intergenic
992154261 5:73939496-73939518 CCCTCAAGGCAGGGGAGGGGAGG - Intronic
992192673 5:74309224-74309246 CATTATGGGAAGGTGAGGGGTGG + Intergenic
993269654 5:85778034-85778056 TCTTTTGGGGTGGGGAGGGTAGG - Intergenic
994129832 5:96213851-96213873 CCTCTTGGGAAGGGGATGGGAGG - Intergenic
994535969 5:101029793-101029815 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
994570944 5:101513141-101513163 CCTTGGGGGGGGGGGGGGGGGGG + Intergenic
994591514 5:101779151-101779173 ACTACTGGAGAGGGGAGGGAGGG + Intergenic
994956109 5:106535176-106535198 CCTACTTGGGAGTGGAGGGTGGG - Intergenic
995781744 5:115783935-115783957 TCCTCTGAGGAGGGGAAGGGAGG - Intergenic
996300080 5:121971438-121971460 CCTTCTTTTGTGGGGAGGGGGGG - Intronic
996536236 5:124580996-124581018 GCTTTGGGGAAGGGGAGGGGAGG - Intergenic
996571400 5:124935983-124936005 GCCTCTGGGGAGGGAAGGGGGGG - Intergenic
996681575 5:126233161-126233183 TCTACTGGAGAGGGGAGGGTAGG + Intergenic
996823128 5:127652663-127652685 CCATCTGTGGAGAGGAGGGGAGG - Intronic
997283874 5:132664810-132664832 CCCTCTCGGGAGAGGAGGTGGGG + Intergenic
997298651 5:132786000-132786022 CCTGCTGGGGTGGGGAGCAGGGG + Intronic
997695699 5:135858951-135858973 ACTACTGGAGAAGGGAGGGGAGG + Intronic
997811450 5:136974396-136974418 CTGGCTGGGGAGGGGAGGGAAGG + Intergenic
997884139 5:137615528-137615550 GCCTCTGGGGAGGGGGGGCGGGG - Intergenic
998207170 5:140166152-140166174 CCTTCCAGGCTGGGGAGGGGAGG + Intergenic
998238370 5:140419996-140420018 CTGTGTGGAGAGGGGAGGGGAGG - Intronic
998385985 5:141757502-141757524 CCATCTGGGGGTGGGAGGTGGGG - Intergenic
998501317 5:142635459-142635481 CCTTCTGTGGAAGGGGCGGGGGG - Intronic
998725330 5:145006506-145006528 CTGTCTGGGAAGGGGAGGGGAGG - Intergenic
999147163 5:149404070-149404092 GCTTCTTGGGAGGTGAAGGGAGG - Intronic
999266567 5:150270587-150270609 GCCTCGGGGGCGGGGAGGGGGGG - Intronic
999270647 5:150294703-150294725 GCTTGTGGGGAGGGAAGGGAGGG - Intergenic
999287951 5:150405320-150405342 CCATGATGGGAGGGGAGGGGAGG + Intronic
999460509 5:151753779-151753801 CCTACTGGGGAGAGAACGGGAGG + Intronic
999825956 5:155274105-155274127 CCCTCTGGGGAGGGGCAGGCGGG - Intergenic
1000906876 5:166974925-166974947 TATTCTGGGGAGGGGGGTGGAGG + Intergenic
1001037908 5:168311167-168311189 GCTGCCTGGGAGGGGAGGGGAGG - Intronic
1001312998 5:170624672-170624694 TCTTGTGTGGAGGGGAGGAGAGG + Intronic
1001366091 5:171141493-171141515 GCTTCTGGGGAGGCGGAGGGAGG + Intronic
1001425464 5:171619409-171619431 CCCCCTGGGGTGGGGTGGGGGGG + Intergenic
1001630116 5:173168665-173168687 CCTGGGGGTGAGGGGAGGGGTGG + Intergenic
1001648154 5:173297374-173297396 ATTCCTGGTGAGGGGAGGGGAGG - Intergenic
1001871443 5:175159617-175159639 CATGATGGGGAGTGGAGGGGTGG + Intergenic
1002063900 5:176642854-176642876 CCACCTGGGGCGGGGGGGGGGGG - Intronic
1002441180 5:179265313-179265335 CCATGTCGGGAGGGGAGAGGTGG + Intronic
1002575429 5:180171281-180171303 GTTTCTGGGGAAGGGAGGGCAGG + Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002670249 5:180861047-180861069 GTTTCTGGGGAGCGGAGGGGAGG - Intronic
1002696961 5:181098290-181098312 ACTGGAGGGGAGGGGAGGGGAGG + Intergenic
1002817355 6:693183-693205 CCTTCAGGGGAGGGTAGAGGAGG + Intergenic
1002835259 6:860336-860358 CCATCAGGGCAGGGGAGGAGAGG - Intergenic
1003014379 6:2456116-2456138 TTCTCTGGGGAGGAGAGGGGAGG + Intergenic
1003123906 6:3340056-3340078 CCCTGTGGGGAGAGGAGAGGAGG - Intronic
1003146106 6:3511905-3511927 CCTTCTGGGGAGGGCTCAGGTGG - Intergenic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004667315 6:17760681-17760703 CCCACTGGGGAGGGGAAAGGAGG + Intronic
1004741980 6:18471173-18471195 TTTTGTGGGGAGTGGAGGGGTGG + Intergenic
1004914469 6:20319152-20319174 CCGTCAGGAGAGGGTAGGGGAGG - Intergenic
1005382517 6:25251231-25251253 CCTTCTGTGGTGAGGAGGAGTGG + Intergenic
1005402820 6:25451988-25452010 TATTCTGGGGGGGGGAGGGGGGG - Intronic
1005519205 6:26583930-26583952 TTTTCTGGGGTGGGGTGGGGTGG + Intergenic
1005570877 6:27144455-27144477 CTGTCTGGGGGGGGGGGGGGGGG + Intergenic
1005638813 6:27775479-27775501 CATTTGGTGGAGGGGAGGGGAGG + Intergenic
1005740329 6:28785397-28785419 CCTTCTGGGGGAGGGGGTGGAGG - Intergenic
1005825057 6:29627643-29627665 CGTTCTGAGGAGGGGTGCGGGGG + Exonic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1006118946 6:31792381-31792403 CCTCCAGGGGAGGTGAGGCGAGG - Exonic
1006154966 6:32009020-32009042 CCATCAGGTGAGGGGTGGGGAGG - Intergenic
1006161277 6:32041755-32041777 CCATCAGGTGAGGGGTGGGGAGG - Exonic
1006340983 6:33446901-33446923 CTTCCTGGGGAGGAGAGTGGTGG - Intronic
1006400163 6:33813089-33813111 CCCTCTGGGGGGGCGGGGGGCGG + Intergenic
1006438594 6:34039894-34039916 CCCACTGAGGAGGGGATGGGGGG - Intronic
1006814428 6:36840463-36840485 CCTTCTGGGGAGGTGTGTGGGGG + Intergenic
1006891533 6:37433337-37433359 GCTGCCGGGGAGCGGAGGGGGGG - Exonic
1006898462 6:37485060-37485082 CCTGATGGGGAAGGGTGGGGTGG + Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1007334802 6:41148044-41148066 CCTGCTGGGGAGTGGAGAGGTGG - Intergenic
1007377523 6:41466966-41466988 GCCAGTGGGGAGGGGAGGGGAGG - Intergenic
1007393732 6:41565487-41565509 CGTGCTGGGGTGGGGAAGGGAGG - Intronic
1007557977 6:42782639-42782661 GGTGGTGGGGAGGGGAGGGGAGG + Intronic
1007630564 6:43270886-43270908 CCTTCTGAGAAGGGCAGAGGTGG - Intronic
1007655760 6:43450192-43450214 CCTTCTGGGGAAGTGTGGAGAGG - Exonic
1007698051 6:43746431-43746453 AGTTCTGGGGTGGGGAGAGGAGG + Intergenic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1007818141 6:44539288-44539310 CTTTCCTGGGAGAGGAGGGGAGG - Intergenic
1008107190 6:47451721-47451743 TCCTCTGGGGTGGGGTGGGGTGG - Intergenic
1008372142 6:50744944-50744966 CTTTTTGGGGGGAGGAGGGGAGG - Intronic
1008489835 6:52074883-52074905 CCTTCTGGGGAAAGGATTGGTGG - Intronic
1008506285 6:52233875-52233897 CCTTTTAGGGAAGGGAGTGGGGG + Intergenic
1009885112 6:69616379-69616401 CCTTCTGATGAGGGTAGGAGAGG - Intergenic
1010191058 6:73197123-73197145 CCTGTTGGGGAGGGCTGGGGAGG - Exonic
1010280575 6:74018592-74018614 CCTTCTGGGGTGGGGCCAGGGGG + Intergenic
1010708206 6:79139517-79139539 CCTATTGGGGGGTGGAGGGGAGG + Intergenic
1010915293 6:81609462-81609484 CTTTCTGGGAATGGCAGGGGAGG + Intronic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1012875405 6:104720629-104720651 CCGTCTGGGGGGGGGGGGAGGGG - Intergenic
1013284437 6:108668702-108668724 CCAGATGGAGAGGGGAGGGGTGG + Intronic
1013687383 6:112601222-112601244 CATCCTGGGTAGGAGAGGGGTGG - Intergenic
1014602835 6:123436672-123436694 CCGTCTGGGGAGGGCAGGCTGGG - Intronic
1014957126 6:127634442-127634464 CTTTCAGAGGATGGGAGGGGAGG + Intergenic
1015840652 6:137473412-137473434 CCTCAGAGGGAGGGGAGGGGCGG + Intergenic
1016011927 6:139146056-139146078 TGTTCTTGGTAGGGGAGGGGAGG - Intronic
1016459371 6:144266136-144266158 CCTGCTGGATGGGGGAGGGGTGG - Intergenic
1017061782 6:150491311-150491333 CCACCTGGGGAGGGGAAGGGAGG - Intergenic
1017181994 6:151563128-151563150 CATTCTGTGTAGGGAAGGGGAGG + Intronic
1017563611 6:155660542-155660564 GCTTGGGGGAAGGGGAGGGGTGG + Intergenic
1017793814 6:157823607-157823629 CCTTCTGGGCATGGGTGCGGCGG + Intronic
1018398204 6:163397472-163397494 TGTTGTGGGGAGGGGAGGGCTGG - Intergenic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1018798859 6:167207545-167207567 CATGCTGGGGAGGGCCGGGGAGG + Intergenic
1018813751 6:167316424-167316446 GGGTCTGGGGAGGGGTGGGGGGG - Intergenic
1018865996 6:167747624-167747646 CATGCTGTGGAAGGGAGGGGGGG + Intergenic
1018898282 6:168036405-168036427 CTCTCTGGGGCGGGGAGGGGCGG - Intronic
1018945297 6:168343694-168343716 CCATGTGGGGAGGGATGGGGAGG - Intergenic
1019108302 6:169688354-169688376 CCTTTTGGGGAGGAGAGAAGTGG + Intronic
1019225472 6:170504137-170504159 CCTTCTGGGGAAGGGAATGTGGG + Intergenic
1019341362 7:510485-510507 TCGGGTGGGGAGGGGAGGGGAGG + Intronic
1019341398 7:510583-510605 TCGGGTGGGGAGGGGAGGGGAGG + Intronic
1019366686 7:636723-636745 CCTGCTGGGGAGGGGGCCGGCGG + Intronic
1019483595 7:1277343-1277365 CCTACTGGGGGGGGGGAGGGAGG - Intergenic
1019607820 7:1918876-1918898 CCCTGTAGAGAGGGGAGGGGAGG - Intronic
1019714079 7:2530395-2530417 CCTTCTGGGGGGTGGGGGGGCGG - Intergenic
1020013147 7:4817130-4817152 CCTTCTGGGGGGCTGAGGGAGGG - Intronic
1020080101 7:5282442-5282464 ACTTTGGAGGAGGGGAGGGGTGG + Intronic
1020262186 7:6536668-6536690 CCTGGTGGGGAGGGGCGGGACGG + Intronic
1020347653 7:7182770-7182792 CCTCCTGGGGGGCGGAGAGGGGG - Exonic
1021400352 7:20203224-20203246 CCATGTGGTGTGGGGAGGGGAGG - Intronic
1021525004 7:21577286-21577308 CTTCCTGGCAAGGGGAGGGGTGG - Intronic
1021733286 7:23618268-23618290 ACTTCCAGGGAGGGGAGGAGGGG - Intronic
1022093869 7:27125908-27125930 CCCTATGGGGTGGGGTGGGGTGG - Intronic
1022113327 7:27244247-27244269 CCTTCTGGGGAGGTGATTGTTGG - Intronic
1022299705 7:29091514-29091536 ACGTCTGTGGAGGGAAGGGGAGG + Intronic
1022503656 7:30897493-30897515 TGTGCTGGGGAGGGGAGGGGAGG - Intergenic
1023095617 7:36656842-36656864 GCTTGGGGGAAGGGGAGGGGTGG + Intronic
1023532565 7:41173677-41173699 AGTTGTGGGGAGGGGAGGGTGGG - Intergenic
1023629632 7:42151177-42151199 CCTTTTGGAGCGGGGAGGTGTGG - Intronic
1023633382 7:42184924-42184946 GCATCTGGGGAAGAGAGGGGAGG - Intronic
1023722943 7:43113656-43113678 GCTGCCGGGGCGGGGAGGGGGGG + Intronic
1023800342 7:43828411-43828433 CAATCGGGGGGGGGGAGGGGGGG - Intergenic
1023828263 7:44024280-44024302 GGATCTGGGGAGGGGAGGAGAGG + Intergenic
1023910031 7:44547259-44547281 CAGGATGGGGAGGGGAGGGGAGG + Intergenic
1025032860 7:55571940-55571962 CCCTCTGCGGCGGGGAGAGGGGG + Intronic
1025198820 7:56949774-56949796 ACTTTGGAGGAGGGGAGGGGTGG - Intergenic
1025270530 7:57508713-57508735 GCTTCTGGGGAGGGAAGCGAGGG - Intergenic
1025673126 7:63627159-63627181 ACTTTGGAGGAGGGGAGGGGTGG + Intergenic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026458056 7:70589957-70589979 CCTCCTGGGGAGGGGAAGAAAGG - Intronic
1026690162 7:72544203-72544225 AAACCTGGGGAGGGGAGGGGAGG + Intergenic
1026774558 7:73223361-73223383 CCAGCTTGGGTGGGGAGGGGAGG - Intergenic
1026828218 7:73596786-73596808 CCTGCTGGGGTGGAGAAGGGCGG + Exonic
1027015416 7:74776750-74776772 CCAGCTTGGGTGGGGAGGGGAGG - Intronic
1027072615 7:75169205-75169227 CCAGCTTGGGTGGGGAGGGGAGG + Intergenic
1027173844 7:75890867-75890889 CTGTCTGGGGATGGGAGGGGAGG - Intergenic
1027390698 7:77700867-77700889 CCTTCTGGGGCCGGGCGCGGTGG + Intronic
1027995402 7:85419425-85419447 CCTTCTCCGGGGGGGAGGGGGGG - Intergenic
1028554580 7:92108405-92108427 CTTTTTGGGGAAGGGAGTGGAGG + Intronic
1029000667 7:97151342-97151364 GCTTCTAGGGAGTGGAGGTGAGG + Intronic
1029042029 7:97586301-97586323 CCTGTTGGGTAGGGGAAGGGAGG + Intergenic
1029408193 7:100390383-100390405 GTTCCTGGGGAGGAGAGGGGAGG + Intronic
1029535390 7:101154691-101154713 CATTCGGGAGAGGGGCGGGGAGG + Intronic
1029545283 7:101207308-101207330 CTGTCCAGGGAGGGGAGGGGAGG + Intronic
1029599222 7:101553941-101553963 GCTTCTGGGAGGAGGAGGGGAGG + Intronic
1029706697 7:102280132-102280154 CAGCCTGGGCAGGGGAGGGGAGG + Intronic
1029756564 7:102577726-102577748 GGATCTGGGGAGGGGAGGAGAGG + Intronic
1029774506 7:102676795-102676817 GGATCTGGGGAGGGGAGGAGAGG + Intergenic
1030106838 7:105994690-105994712 TCTTCTGGGGAAGGGTGGGCAGG + Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1030128654 7:106178624-106178646 CCTTGAGGGGAGGAGAGGAGAGG + Intergenic
1030262550 7:107580447-107580469 CCTTCTGGGAGCGGGAGGGCCGG + Intronic
1030396074 7:108988491-108988513 CCTGGTGGGGCAGGGAGGGGTGG + Intergenic
1030481774 7:110113619-110113641 CCTGGTGGGGGGGGGGGGGGTGG - Intergenic
1030512848 7:110505980-110506002 ACTTCTTGAAAGGGGAGGGGAGG + Intergenic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031291772 7:119947164-119947186 CCTTCTGGGAAGGGAATGGGAGG - Intergenic
1031442511 7:121811742-121811764 CCTTCTGTTGAGGAAAGGGGAGG + Intergenic
1031493667 7:122420901-122420923 CCTACTGGGGAAGGGGAGGGAGG + Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032178713 7:129656443-129656465 ACTTCTGGGGTGGGGGGGAGTGG + Intronic
1032275110 7:130447428-130447450 GCTTCTGGGGTGGGGGTGGGAGG + Intergenic
1032389132 7:131544447-131544469 GCTTCTGGGGAAGGGCAGGGTGG - Intronic
1032440292 7:131937559-131937581 AGTTGTGGGGTGGGGAGGGGAGG + Intergenic
1032514544 7:132496873-132496895 CCTCCTTGGGAGGGGAGAGTTGG - Intronic
1032967111 7:137110600-137110622 TTTTCTGGGCAGGGGATGGGTGG + Intergenic
1033288495 7:140062221-140062243 CCGTGTGGGGTGGGGAGGGAGGG - Intronic
1033707396 7:143902581-143902603 CCTGGAGGGGAGGGGAGGGGAGG - Intergenic
1033780662 7:144665076-144665098 CCTGTTGTTGAGGGGAGGGGAGG + Intronic
1034072783 7:148203172-148203194 TCTTTTGGGGAGGAGAGGTGGGG + Intronic
1034149006 7:148898626-148898648 TCTGCTGGGGTGGGTAGGGGAGG - Intergenic
1034164419 7:149014554-149014576 CTTCATGGGGAGGGGAGGGGAGG - Intronic
1034422464 7:150996744-150996766 GCTCCTGGGGAGGAGAGGGGTGG - Exonic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034535415 7:151723014-151723036 CCTGCGGTGGAGGGGAGGAGTGG - Intronic
1034935244 7:155194996-155195018 CCAGCTGGGGAGGGGTGTGGAGG + Intergenic
1035122068 7:156577002-156577024 CTGTCTGGGGAGGTGAGGGTCGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035323912 7:158052655-158052677 CCTCCTGGAGAGGGTAGAGGGGG + Intronic
1035403408 7:158583469-158583491 CCTGCCAGGGAGGGGAGGTGGGG - Intronic
1035438638 7:158878342-158878364 CCATGTGGGGAGGCGAGGAGGGG + Intronic
1035438706 7:158878565-158878587 CCATGTGGGGAGGCGAGGAGGGG + Intronic
1035438758 7:158878746-158878768 CCATGTGGGGAGGCGAGGAGGGG + Intronic
1035438813 7:158878927-158878949 CCATGTGGGGAGGCGAGGAGGGG + Intronic
1035464411 7:159065277-159065299 ACTGCAGGGGAGGGGAGGGAGGG - Intronic
1036065235 8:5373134-5373156 GGTACTGGGGAGGTGAGGGGAGG + Intergenic
1037127150 8:15365369-15365391 AGGGCTGGGGAGGGGAGGGGTGG + Intergenic
1037217520 8:16475664-16475686 ACTACTGGGGAGGGGAGGTGGGG - Intronic
1037346611 8:17907771-17907793 CCTTCTGGGGAATGGAGCAGGGG + Intronic
1037347617 8:17916300-17916322 CCTTCTGGGGAATGGAGCAGGGG + Intergenic
1037471408 8:19215125-19215147 CATGCGGGAGAGGGGAGGGGAGG + Intergenic
1037579405 8:20235830-20235852 CCCTGTGGGGAGAGAAGGGGTGG - Intergenic
1037654213 8:20868920-20868942 CTTTCTGGTGTGGGGAGGAGGGG - Intergenic
1037820819 8:22133772-22133794 CCTGGAGGGGAGGGGAGGTGGGG - Intergenic
1037827799 8:22169734-22169756 CCTTCTGGGGAAGTGGGGAGAGG - Intronic
1038314396 8:26471083-26471105 ACTTCTGGGGAAGAGAGTGGGGG + Intronic
1038894349 8:31764885-31764907 CCTTGTGGGGTGGGGGGAGGGGG - Intronic
1039268094 8:35850218-35850240 CATTATGGGGATGGGAGGGAGGG - Intergenic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1039473797 8:37828985-37829007 CTCCCTCGGGAGGGGAGGGGTGG - Intronic
1039845309 8:41321595-41321617 CCCTCTGGGGTGGGGACCGGTGG + Intergenic
1040567778 8:48582607-48582629 CGCTCCGGGGAGGGGAGGGAGGG + Intergenic
1040876275 8:52155571-52155593 CCTTCTGTGTTGGGAAGGGGTGG + Intronic
1041312302 8:56529542-56529564 CCTACTGGGGTGGGGGCGGGGGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1041715024 8:60924644-60924666 CAGGATGGGGAGGGGAGGGGAGG - Intergenic
1041771016 8:61472327-61472349 GTTTCTGGAGAGGGGAGGGAAGG + Intronic
1042376792 8:68061261-68061283 CATACTGGCGAGGGGAGGTGTGG + Intronic
1043030224 8:75124990-75125012 CCTTCAGTGGAGGTGGGGGGCGG - Intergenic
1045068934 8:98479480-98479502 CCGTCTCGGGGGGGGGGGGGGGG + Intronic
1045115040 8:98972924-98972946 CCTTATGTGGGGGGGCGGGGCGG + Intergenic
1045335910 8:101204914-101204936 CGTTTTGGGGAGAGGAGAGGAGG + Exonic
1045407707 8:101883464-101883486 CATTCTGGAGTGGTGAGGGGAGG - Intronic
1045468698 8:102491844-102491866 CTTTCTGGGGAGGGCAGGCATGG + Intergenic
1046736716 8:117783931-117783953 GCTTCTGAAGATGGGAGGGGAGG - Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1047751266 8:127882420-127882442 TCTTCTGAGGAAGGGAGAGGTGG - Intergenic
1047826535 8:128582187-128582209 ACAAATGGGGAGGGGAGGGGAGG - Intergenic
1048095700 8:131290848-131290870 CTTCTTGGTGAGGGGAGGGGAGG - Intergenic
1048214183 8:132480663-132480685 GCTTTTGGGGGGGGGTGGGGAGG - Exonic
1048327968 8:133453246-133453268 CATTTTGGGGAGGGGTCGGGGGG + Intergenic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048866300 8:138764221-138764243 CCCTCTGGGGATGGCAGGGCAGG + Intronic
1048972591 8:139653608-139653630 CCTTGGGGTGAGGGAAGGGGTGG - Intronic
1049405281 8:142449614-142449636 CTTCCTGGCGAGGGGGGGGGGGG - Exonic
1049522548 8:143101510-143101532 CCTTGTGGGGTAGGGAGGGAAGG + Intergenic
1049528597 8:143142359-143142381 CCTCCTGGGGAGGGAAGGACAGG - Intergenic
1049637867 8:143698895-143698917 ACGTGTGGGGAGGGGAGGAGTGG - Intronic
1049707639 8:144050284-144050306 TCTTCTGCGTGGGGGAGGGGGGG - Intergenic
1049708026 8:144051680-144051702 CCGGGAGGGGAGGGGAGGGGAGG + Intronic
1049735357 8:144202251-144202273 CTGTCTGTGGAGGGGCGGGGAGG + Intronic
1049735386 8:144202349-144202371 CCCTCTGTGGAGGGGAAAGGAGG + Intronic
1049735413 8:144202446-144202468 CCCTCTGTGGAGGGGAAGAGAGG + Intronic
1049735465 8:144202610-144202632 CTCTCTGTGGAGGGGTGGGGAGG + Intronic
1049735525 8:144202807-144202829 CTCTCTGTGGAGGGGCGGGGGGG + Intronic
1049735539 8:144202838-144202860 CTCTCTGTGGAGGGGCGGGGGGG + Intronic
1049735582 8:144202970-144202992 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735597 8:144203004-144203026 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735611 8:144203037-144203059 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735656 8:144203141-144203163 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735672 8:144203176-144203198 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735686 8:144203209-144203231 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735700 8:144203242-144203264 CTGTCTGTGGAGGGGCGGGGGGG + Intronic
1049735733 8:144203342-144203364 CTCTCTGTGGAGGGGCGGGGAGG + Intronic
1049745800 8:144262808-144262830 CCTGCAGGTGAGGGGTGGGGGGG - Intronic
1050105893 9:2166415-2166437 TGTTCTGGGGTGGGGAGTGGGGG - Intronic
1050954972 9:11644803-11644825 TGTTGTGGGGTGGGGAGGGGGGG - Intergenic
1051263057 9:15284724-15284746 TCTTCTGAGGAGAGGAAGGGAGG + Intronic
1051393462 9:16592105-16592127 TTTTGGGGGGAGGGGAGGGGTGG - Intronic
1052024072 9:23555816-23555838 CCTCCTGGGAAGGGGAGAGAAGG + Intergenic
1052207025 9:25854926-25854948 TCTTCTGGGGGTGGGAGAGGGGG - Intergenic
1052996384 9:34553602-34553624 CCTGCTGGGGCGGAAAGGGGTGG + Intronic
1053153392 9:35756968-35756990 CCTGCTGGGGAGGGGGTGAGTGG + Exonic
1053225016 9:36347114-36347136 CCATCTCGGGGGGGGGGGGGGGG + Intronic
1053530160 9:38873143-38873165 CCTGGTGGGGGGCGGAGGGGGGG + Intergenic
1053533482 9:38904384-38904406 GCATATGGGGAGGGGCGGGGAGG - Intergenic
1053656585 9:40222914-40222936 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1053810765 9:41849420-41849442 GATTTTGGGGAGGGGAAGGGAGG + Intergenic
1053874972 9:42534859-42534881 CCGTCTGGGGCGGGGGGTGGGGG + Intergenic
1053906939 9:42852136-42852158 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1054205707 9:62128813-62128835 GCATATGGGGAGGGGCGGGGAGG - Intergenic
1054357004 9:64071361-64071383 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054368689 9:64369136-64369158 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054451178 9:65404279-65404301 CCTCCTGGGGTGGGGTGGGAGGG - Intergenic
1054528030 9:66153371-66153393 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1054619828 9:67338019-67338041 GATTTTGGGGAGGGGAAGGGAGG - Intergenic
1054632654 9:67459557-67459579 GCATATGGGGAGGGGCGGGGAGG + Intergenic
1054635973 9:67490790-67490812 CCTGGTGGGGGGCGGAGGGGGGG - Intergenic
1054676318 9:67858888-67858910 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1055570342 9:77610120-77610142 TCCTCTGGGAAGGTGAGGGGTGG - Intronic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1055818927 9:80238770-80238792 CCTGTTGGTGTGGGGAGGGGGGG - Intergenic
1056389379 9:86126552-86126574 CCTTTTGTGGAGAGGAGAGGGGG - Intergenic
1056669588 9:88615029-88615051 CCGTTGGGGGAGGGCAGGGGTGG - Intergenic
1056715241 9:89023074-89023096 CCTTCTTTGGAAGGGAGGGCAGG + Intronic
1057018972 9:91681165-91681187 CCTGCTGGGGTGGGGTGGGGCGG - Intronic
1057023465 9:91718578-91718600 CATCCTGGGGCGGGGGGGGGGGG + Intronic
1057143270 9:92740522-92740544 TGTGCTGGGGCGGGGAGGGGGGG + Intronic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1057757791 9:97851940-97851962 CTTTCCGGGGTGGGGGGGGGGGG - Intergenic
1058711291 9:107681702-107681724 CCTTCAGAGGCTGGGAGGGGAGG + Intergenic
1058781386 9:108339517-108339539 CCTTTTGGGGTGGGGGTGGGAGG + Intergenic
1058973295 9:110102605-110102627 CCCAATGGGGAGGGGAGGGGAGG - Intronic
1059010496 9:110453578-110453600 CATTCTGGCCAGGGGCGGGGTGG + Intronic
1059456222 9:114402015-114402037 CCATGTGGGGAGGGGTGGGCAGG - Intergenic
1059656866 9:116365334-116365356 CCTTCCCGGGAGGCGCGGGGAGG - Intronic
1059732996 9:117075170-117075192 CCTTCTGGGGCAAGAAGGGGTGG + Intronic
1059785750 9:117581884-117581906 ACTTCTGGGTGGGGGCGGGGGGG - Intergenic
1059792363 9:117653972-117653994 TCTTCAGGGGATGGGAGAGGAGG - Intergenic
1060239402 9:121889893-121889915 CCATCTTGGGCGGGGCGGGGGGG + Intronic
1060257757 9:122047514-122047536 TCTTCTGGGGAGAGGGGGTGGGG - Intronic
1060450844 9:123737647-123737669 CATTTTGGGGATGGGAGGAGCGG - Intronic
1060550881 9:124484863-124484885 CCCTTTGGGGAGGGGTGGAGGGG + Intronic
1060662142 9:125410842-125410864 CCTTCTGGGTCAAGGAGGGGAGG - Intergenic
1060744797 9:126124209-126124231 CCTCCTGGGGCGGGGGGGGGGGG - Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061046714 9:128169264-128169286 CTCTCAGGGGAGGGGTGGGGTGG - Intronic
1061081155 9:128371226-128371248 CATCGAGGGGAGGGGAGGGGAGG - Intergenic
1061178438 9:129010718-129010740 CCAGCAGGGGAGGGGAGAGGAGG + Intronic
1061226305 9:129282976-129282998 CTTTGTGGGGAGGGCAGGGGTGG - Intergenic
1061278174 9:129581505-129581527 CCTTCTGGGGGGAAGAGGAGGGG + Intergenic
1061280824 9:129597035-129597057 CCTGCGGGGGATGGGAGGGAAGG - Intergenic
1061523554 9:131138238-131138260 GGTTATGGGGAGGGGAGGGGAGG - Intronic
1061746733 9:132745652-132745674 CTTTCCGGGTAGTGGAGGGGAGG + Intronic
1061806586 9:133140584-133140606 CCTTCTGGGAAGGATAAGGGGGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1062015869 9:134291173-134291195 CCTTCTGGGGCTGAGAGGGAAGG - Intergenic
1062028899 9:134353086-134353108 CCTTCTGGAGGGGGGAGGAGGGG + Intronic
1062033378 9:134372026-134372048 CTCCCTGGGGAGGGGAGGAGAGG + Intronic
1062120888 9:134833553-134833575 GCTTCTGGGAAGGGGAGGAGTGG + Intronic
1062136409 9:134930750-134930772 CCGTCGGGGGCGGGTAGGGGGGG - Intergenic
1062174575 9:135153821-135153843 CCTGCTGGGGTGCAGAGGGGTGG - Intergenic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1062221682 9:135419425-135419447 CCTGCTGGGGAAGGGAGGGATGG - Intergenic
1062266796 9:135690302-135690324 CCCTGAGGGGAGGGGTGGGGTGG - Intergenic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062350928 9:136138331-136138353 GGTTTTGGGGAGGGGAGAGGAGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062410900 9:136423774-136423796 CCTTCTCGCCTGGGGAGGGGCGG + Intergenic
1062686065 9:137814067-137814089 CCTTGTGGGGCGGGGGGCGGGGG - Intronic
1203696979 Un_GL000214v1:108661-108683 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1203748543 Un_GL000218v1:58100-58122 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1203463902 Un_GL000220v1:68266-68288 CCTTCTGGGGGGGAGGGAGGTGG - Intergenic
1203561177 Un_KI270744v1:59920-59942 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1185581459 X:1213418-1213440 CCATCCATGGAGGGGAGGGGAGG - Intergenic
1185586107 X:1243101-1243123 CCTTCCTGGGCGGGGAGGGTGGG - Intergenic
1185608253 X:1379592-1379614 CCCGCTGGGCAGGGCAGGGGAGG - Intronic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1185860415 X:3573495-3573517 TCTTCTGGGGAAGGGAGAGGAGG + Intergenic
1186347354 X:8707767-8707789 TCTGCCGGGGTGGGGAGGGGAGG + Intronic
1186355804 X:8788419-8788441 CCTTCTGGGGGTTGTAGGGGAGG - Intergenic
1186377540 X:9020541-9020563 CCTTCTGGGGGTTGTAGGGGAGG - Intergenic
1186451146 X:9674688-9674710 GCTACTGGGGGGGGGGGGGGGGG - Intronic
1186539904 X:10389716-10389738 CCTTGTGGGGGGGGGGGGGGTGG + Intergenic
1186876109 X:13819885-13819907 CCTGCTGGGTAGGGTAGGGAAGG + Intronic
1187174314 X:16882647-16882669 GGTGCTGGGGAGGGGCGGGGCGG - Intergenic
1188099691 X:26069306-26069328 TCTGCTGGGGAGGACAGGGGAGG - Intergenic
1188236789 X:27741335-27741357 GGCTCTGGGGAGGGGAGGAGAGG - Intronic
1188574900 X:31636183-31636205 CCTACTGGAGTGGGGAGGGTGGG + Intronic
1188767765 X:34117601-34117623 ACTTCTGGCAAGGGGAGGGACGG - Intergenic
1189317110 X:40064105-40064127 GCTTTGGGGGAGGGGAGGTGTGG + Intronic
1189333329 X:40155839-40155861 GCGGCTGGGGTGGGGAGGGGGGG + Intronic
1189456622 X:41196161-41196183 CCTCTTGGGGAGGAGAGGTGGGG - Intronic
1189904834 X:45747139-45747161 CCTTCTGGGGAGGGGCTCTGTGG + Intergenic
1190302681 X:49065640-49065662 GCTCCTGCGGAGGGGAGGAGGGG - Intronic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191215707 X:57930632-57930654 TTTTCTGGGGAGTGGAGGGAAGG + Intergenic
1192180738 X:68914138-68914160 CATAGTGGGGCGGGGAGGGGGGG + Intergenic
1192212412 X:69136503-69136525 CCTTCTTGGGAGGCCAGAGGTGG + Intergenic
1192687010 X:73317891-73317913 CCTACTGGAGAGTGGAGGGTTGG - Intergenic
1193011327 X:76677837-76677859 TGTTGTGGGGTGGGGAGGGGGGG + Intergenic
1193468385 X:81872854-81872876 CTTTCTGGGGTGAGGTGGGGTGG - Intergenic
1194232104 X:91336890-91336912 ATGTCTGGGGTGGGGAGGGGCGG + Intergenic
1194245491 X:91506535-91506557 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1194706270 X:97179360-97179382 CTTGTTGGGGAGGTGAGGGGAGG - Intronic
1194938195 X:99977050-99977072 CCTTCTTGGGATGGGAGGCTAGG + Intergenic
1195065953 X:101238476-101238498 CCTTTGTGGGAGGGGAGGGAGGG + Intronic
1195340958 X:103905611-103905633 TCTTTTGGGGTGGGGAGAGGGGG - Intergenic
1195343410 X:103926267-103926289 GCTCCAGGGGAGGGGAGTGGTGG + Intronic
1195574527 X:106435053-106435075 ACCTCTGGGGAGGGAAGGAGTGG + Intergenic
1195702641 X:107716551-107716573 CATCCTGGGAAGGGGCGGGGGGG - Intronic
1195711051 X:107774335-107774357 CCTGCTGGGGAGGCAAGGAGAGG - Intronic
1195864242 X:109412236-109412258 ACTTCTTGTGTGGGGAGGGGAGG + Intronic
1196845861 X:119896392-119896414 GCCTCTGAGAAGGGGAGGGGAGG + Intronic
1197045066 X:121986444-121986466 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
1197371356 X:125629275-125629297 CTTTGTTGGCAGGGGAGGGGGGG + Intergenic
1197863862 X:130997638-130997660 CATTGTGGGGAGGGGTGGGGAGG + Intergenic
1197953017 X:131918339-131918361 ACTTCTGGGGAGTGGGGGAGGGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198462707 X:136878631-136878653 GCTACTGGGGGGGGGGGGGGGGG + Intronic
1198482759 X:137056081-137056103 CTTTCTTGGGAGGGCAGGGCAGG + Intergenic
1198799136 X:140431866-140431888 AGTTCTGGGGCGGTGAGGGGAGG - Intergenic
1199382200 X:147183781-147183803 CCCTCTTGGGTGGGAAGGGGAGG - Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1199674737 X:150178467-150178489 CCTTTTAGAGAGGGGAGGGTGGG + Intergenic
1199728404 X:150606964-150606986 CCATTTTGGGAGGGGAGGGGAGG - Intronic
1199814705 X:151387117-151387139 CCATCTGGGAAGTGAAGGGGCGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1199979956 X:152915383-152915405 CCTTTTGGGAAGGGGAGTGTAGG + Intronic
1200072084 X:153534184-153534206 GGTCCTGGGGTGGGGAGGGGAGG + Intronic
1200097528 X:153671221-153671243 CCTGCTGGGTTGGGGAGGGTGGG - Intronic
1200099900 X:153685186-153685208 GCTGCTGGGGAGGGGCAGGGTGG - Intronic
1200564461 Y:4747787-4747809 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1200804825 Y:7422494-7422516 CCTTCTGGGGAAGGGAGAGGGGG - Intergenic
1201144897 Y:11058943-11058965 GCATCTGGGGAGGGGAGCGGGGG + Intergenic
1201161888 Y:11173070-11173092 CGTTCTGAGGAGGAGCGGGGCGG + Intergenic
1201687886 Y:16727437-16727459 CATTCAGGGAAGTGGAGGGGAGG + Intergenic
1202389449 Y:24354921-24354943 TCTTGAGGGGAAGGGAGGGGAGG + Intergenic
1202481338 Y:25315198-25315220 TCTTGAGGGGAAGGGAGGGGAGG - Intergenic